ID: 988493348

View in Genome Browser
Species Human (GRCh38)
Location 5:31723962-31723984
Sequence TTCCTGCCTCTTCATGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988493348_988493349 -2 Left 988493348 5:31723962-31723984 CCTCTCTCATGAAGAGGCAGGAA 0: 1
1: 0
2: 0
3: 26
4: 197
Right 988493349 5:31723983-31724005 AAATTTTGATATAAATGCACAGG 0: 1
1: 1
2: 4
3: 36
4: 497

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988493348 Original CRISPR TTCCTGCCTCTTCATGAGAG AGG (reversed) Intronic
902120943 1:14165188-14165210 TTCCTGCCTCTTTAGGACATTGG + Intergenic
903027942 1:20442901-20442923 CTCCTGGCCCTTCCTGAGAGAGG + Intergenic
903523106 1:23969926-23969948 TGCCTGCCTCTTTATGAGGGAGG - Intronic
905509090 1:38504225-38504247 CTCCAGTCTCTTCATGAGTGAGG - Intergenic
907448509 1:54526437-54526459 TTCCAGCCTCTTCATTATTGTGG - Intergenic
910812510 1:91252984-91253006 TACATTTCTCTTCATGAGAGTGG - Intergenic
910934919 1:92479946-92479968 TTCCTGCCTTTTCAGTCGAGAGG + Intronic
915268916 1:154738479-154738501 CTCCTGTGTCTTCCTGAGAGAGG - Intronic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
920257210 1:204663765-204663787 ATCCTGCCTCTCCATTAGTGAGG - Intronic
920346753 1:205310806-205310828 TGCCTGGCTCTTCATGGGACAGG + Intronic
922460869 1:225813467-225813489 CTCCTCCCTCCTCAGGAGAGGGG - Intronic
923237318 1:232046737-232046759 TTCCTTCCTCTACAGGAGAGAGG - Intergenic
923419164 1:233795706-233795728 TTCCTGCCTTATCCTGTGAGAGG - Intergenic
923904777 1:238371774-238371796 TTCCTTCCTATTAATGTGAGTGG + Intergenic
924229997 1:241955109-241955131 TTCCTGCCTTATCACGAGATCGG - Intergenic
924641582 1:245838275-245838297 ATGCTGACTCTTCATGGGAGGGG - Intronic
1063806555 10:9650711-9650733 TTCCTGTCACTTGCTGAGAGGGG - Intergenic
1063879296 10:10514536-10514558 TTCCTGGCACTTCCTGAGGGAGG + Intergenic
1064176386 10:13079252-13079274 CGCGTGCCTCCTCATGAGAGAGG - Intronic
1065325635 10:24548842-24548864 TGCCTGCCTCTTCAGGAAACTGG + Intergenic
1065631904 10:27689231-27689253 TTCTTGGCTCTTCACAAGAGCGG + Intronic
1066503102 10:36013951-36013973 TTCCTTTCTCTTCATGGAAGGGG + Intergenic
1068264716 10:54631791-54631813 TTCCTGCCTCCTTATGAAAAAGG - Intronic
1070190412 10:74106906-74106928 TGACTGCCTCATCATAAGAGAGG + Intronic
1070312436 10:75283514-75283536 GGCCTGCCTCTTCCTGAGGGTGG + Intergenic
1070408588 10:76118569-76118591 ATTCTGCCTTTTCATGACAGAGG + Intronic
1070897486 10:79996938-79996960 TTGTTTCCTCTCCATGAGAGAGG + Intergenic
1072942686 10:99780929-99780951 TTCCTGGCTCTTCTGGTGAGTGG + Intergenic
1073468237 10:103706895-103706917 TTCCTGCCTATTTATGAGGACGG + Intronic
1074010269 10:109471816-109471838 TTCCTGTCTCTGCAGCAGAGTGG + Intergenic
1074744904 10:116522879-116522901 TTCCAGCCTCCCCAGGAGAGTGG - Intergenic
1075022280 10:118960646-118960668 TGCCTGCCTCTTCATGGGGCTGG + Intergenic
1075281183 10:121139767-121139789 TTGCTTCCTCTTCAAGAGTGAGG - Intergenic
1076159824 10:128235093-128235115 TTCCTGCCTCCTGAAGACAGTGG + Intergenic
1076810254 10:132882714-132882736 TTCCCACCTCTTCATGACAGAGG - Intronic
1077404227 11:2375718-2375740 CTCCTCCCACTTCCTGAGAGTGG + Intergenic
1077920592 11:6639286-6639308 TTCCTGCCTCTTCCCCTGAGAGG + Intronic
1079180897 11:18192634-18192656 CTCCTGCCTTTTCCTGAGGGAGG - Intronic
1079940343 11:26672614-26672636 TTCCTCCCTCTTGTTGAGGGTGG + Intronic
1081466914 11:43328723-43328745 TTTCTGCCTCTTCTGGAGGGAGG - Exonic
1083921310 11:65782441-65782463 TTCCTGCCTCACCGTGAGGGTGG - Intergenic
1085803917 11:79617294-79617316 TTCCTGCATCTGCATGAGGAAGG - Intergenic
1085804897 11:79626631-79626653 TTCCTTCCTGTTGATGAGACGGG + Intergenic
1088901408 11:114120495-114120517 TTCTTTCCTCTTCAGGAAAGAGG - Intronic
1090458800 11:126871654-126871676 TTCCTGCTTCTTCAAGGGAGAGG - Intronic
1090751348 11:129748968-129748990 TTCCTGCCTCTTCATAGATGAGG + Intergenic
1091100280 11:132865888-132865910 TTTCTACCACTTCCTGAGAGAGG + Intronic
1092596755 12:10014673-10014695 TTCCTGCCTCTTCAGTACACTGG - Exonic
1092918540 12:13209872-13209894 ATCCTGCCTCTTCAGGGGAGAGG - Intronic
1095814772 12:46409080-46409102 TTGCCACCTCTTCATGAGTGTGG + Intergenic
1096550060 12:52366210-52366232 TGGCAGCCCCTTCATGAGAGAGG - Intronic
1101516781 12:105443648-105443670 TTCTTGTGTCTTCATTAGAGTGG + Intergenic
1102424262 12:112828395-112828417 TTGCTGCATCTTCCTGGGAGTGG + Intronic
1103180547 12:118907490-118907512 TTCTTTTCTCTTCATGAGATTGG - Intergenic
1103571286 12:121846812-121846834 TCCCTGGCTCTGAATGAGAGAGG + Intronic
1105933346 13:25073755-25073777 TTCCTTCCTCTTTTTGAGGGGGG - Intergenic
1106900015 13:34345694-34345716 TTCCTGGATCTTCATGAGAATGG - Intergenic
1107125119 13:36838109-36838131 TTCCTGCCTCCTATTGATAGAGG - Intergenic
1107681938 13:42861190-42861212 TTCCTGCTTGTCCATGGGAGCGG - Intergenic
1110114295 13:71792863-71792885 TACCTGACTCTTCATGAAAGAGG + Intronic
1116027797 14:39536262-39536284 TCCATTCCTCTCCATGAGAGCGG - Intergenic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1118814146 14:69298142-69298164 CTCCTGACTCTTCCTGAGAGAGG - Intronic
1121337234 14:93084884-93084906 TTCCTGCCTCTTGATGAGGAAGG - Intronic
1122515311 14:102304528-102304550 TCCCTGCCTTTTCATGATACTGG - Intronic
1124362646 15:29049419-29049441 TTCCAGACTTTTCATGGGAGGGG - Intronic
1125676422 15:41504688-41504710 TTCCAGCCACCTCATGTGAGGGG - Intronic
1125920867 15:43524905-43524927 ATTCTGCATCTTCAGGAGAGAGG - Exonic
1126709501 15:51441523-51441545 TTCCTTCCACTTCGGGAGAGAGG - Intergenic
1126739969 15:51767858-51767880 TTACTGCTTCTGCAGGAGAGGGG + Intronic
1131128323 15:89875536-89875558 TTCTTGCCTCATCATGAAATAGG - Intronic
1133436372 16:5783757-5783779 ATCCTGCCTCTTCGTGACAAGGG - Intergenic
1133867431 16:9657573-9657595 TTTCTACCTCTTCATCAAAGTGG + Intergenic
1133978523 16:10617284-10617306 TCCCTGCCCCTTGATGGGAGGGG - Intergenic
1136016119 16:27402268-27402290 TGCCTGCCTCTCCCTGAGTGTGG + Exonic
1141910668 16:87056557-87056579 TGGCTTCCTCATCATGAGAGTGG - Intergenic
1143262479 17:5609999-5610021 TTCCTGCATCTTCAGAAGAAGGG + Intronic
1143281396 17:5757327-5757349 CTCTTGCCTCTTCATCACAGAGG + Intergenic
1144294875 17:13864595-13864617 TTCCTTCATTTTCATAAGAGTGG - Intergenic
1147651433 17:42064297-42064319 TTCCTGCCTCTGCTTCAGACAGG + Intronic
1148124939 17:45231645-45231667 TCCCTGCCTCTTTGTGTGAGTGG + Intronic
1149339123 17:55668101-55668123 TTCCTGCTTATTCCTGAAAGTGG - Intergenic
1149434974 17:56625992-56626014 CTCCTGCCACTTCACGGGAGAGG - Intergenic
1151224505 17:72638685-72638707 TGCCTGCCCCATCATGGGAGCGG + Intergenic
1153617579 18:6948620-6948642 TTCCTTCCACTTCATCAGACTGG + Intronic
1154014984 18:10608003-10608025 TTCCTGCCTCTGAACGACAGAGG - Intergenic
1154190530 18:12227641-12227663 TTCCTGCCTCTGAACGACAGAGG + Intergenic
1154375997 18:13810427-13810449 TTCATGTATCTTCATGAAAGAGG - Intergenic
1155004380 18:21714908-21714930 TTACTGCCTTTTCATGAGCTAGG - Intronic
1155039306 18:22051700-22051722 TTCCTGCCTCTCCCTGGGGGAGG - Intergenic
1155040013 18:22057026-22057048 TTCCTGGCTTTTCATGAGAAAGG - Intergenic
1157345250 18:46824020-46824042 TTACTGCCTCTTCATAGGATTGG + Intronic
1157862774 18:51156244-51156266 TGCCTACCTCTTTATGAGGGAGG - Intergenic
1158442064 18:57484833-57484855 GTGCTACCTCTGCATGAGAGCGG + Exonic
1162787872 19:13046896-13046918 TTCCTGACTCTTCAAGAGTCTGG - Intronic
1164432958 19:28204067-28204089 TTCCTTCCCCTTCCTAAGAGAGG - Intergenic
1167720875 19:51179529-51179551 TTCCTGCCACTTCATGACTCTGG - Intergenic
925698360 2:6606818-6606840 ATTTTGCCTCTTCATGAGATAGG + Intergenic
926146271 2:10398727-10398749 TGCCTTCCTCTTCCTGAGGGAGG + Intronic
926417664 2:12665656-12665678 TTCCTTCCTCTACTTCAGAGGGG + Intergenic
927211109 2:20639773-20639795 ATCCTGCCTCTCCACCAGAGAGG + Intronic
927482505 2:23465443-23465465 CTCCTGCCTCTTGCTGATAGAGG - Intronic
929428647 2:41869081-41869103 CTCCTGCCTCAACATGAGACTGG + Intergenic
935094258 2:99928863-99928885 CTGCTGCCACTTCAAGAGAGTGG - Intronic
935753845 2:106261979-106262001 TTCCTGTCACTTCATGCCAGGGG - Intergenic
937513110 2:122620907-122620929 TTCCTGTTTCTTTATGAGAAAGG + Intergenic
940779477 2:157917604-157917626 TTGCTGCTTCTTCTGGAGAGGGG - Intronic
940842002 2:158594528-158594550 TTCCTGGCTTTTCATCAGAATGG - Intronic
946171047 2:217895760-217895782 TTCCTGCCTCTACCTCCGAGGGG + Intronic
947619321 2:231578548-231578570 TTCCAGCATCTTCATGAGGCAGG - Intergenic
948229893 2:236342067-236342089 TTCCTGCCTCTTATTGCGGGAGG + Intronic
1170326162 20:15156670-15156692 TTCCTCCCTTTCCAGGAGAGGGG + Intronic
1172230499 20:33332858-33332880 TTCCTCCCTCTCCATCAGCGAGG - Intergenic
1172293670 20:33793114-33793136 TTCCCGCCTCCTCATGAGCCCGG - Intergenic
1173156489 20:40616704-40616726 TTTCTGTGTCTTCATTAGAGAGG + Intergenic
1173881070 20:46412636-46412658 TTCCTGCTTCTACTTCAGAGAGG + Intronic
1174423835 20:50418148-50418170 TTCCTGCCTCTTCCTAAGACTGG - Intergenic
1175062048 20:56252344-56252366 TTCCTGTGTCATCATGAGAGGGG - Intergenic
1175726267 20:61320754-61320776 TTCCTGCCTCTTCATCTGCTTGG - Intronic
1176901092 21:14443132-14443154 CTTCTGCCTCTTCCTGAGAAAGG - Intergenic
1177581838 21:23033494-23033516 ATTCTTCCTCTTCATGAGAATGG + Intergenic
1179176882 21:39014307-39014329 TTCCCTCGTCTTCATGAGAGAGG - Intergenic
1182410227 22:30178995-30179017 TTCCAGCCTCTTCCTGGAAGAGG - Intergenic
1184017238 22:41795437-41795459 CACCCACCTCTTCATGAGAGAGG - Exonic
1184017347 22:41795947-41795969 CACCCACCTCTTCATGAGAGAGG - Intronic
1184278911 22:43426253-43426275 TTCATGCTTCTGCTTGAGAGCGG + Intronic
1185180032 22:49354587-49354609 TTCCTTCCTCCTCTTGAGGGTGG + Intergenic
1185234849 22:49705790-49705812 TTCCTGCACCTGCATGGGAGGGG + Intergenic
1185234869 22:49705854-49705876 TTCCTGCACCTGCATGGGAGGGG + Intergenic
949495662 3:4629298-4629320 TTCCTGGCTCTTCTTGAGCTAGG + Intronic
950139860 3:10607975-10607997 ATGCTGCCTCTTGATGAGAGAGG - Intronic
953019488 3:39104560-39104582 TTGCTGCCTCCTCATGGGAAAGG + Intronic
953042119 3:39264820-39264842 TTTCTGCTTCTCCATGAGATTGG + Exonic
953673382 3:44981254-44981276 TTCCTGCCTCTTTTTGAATGAGG + Intronic
954499442 3:50996971-50996993 TCCCTGGCTCTTCATCCGAGAGG + Intronic
956285598 3:67606559-67606581 TTCCAGCCTTTTCATAAGAAAGG - Intronic
956765450 3:72480843-72480865 TCCCTGCATGTTGATGAGAGTGG - Intergenic
959118555 3:102206483-102206505 TTCCTTTCACTTCAGGAGAGGGG - Intronic
959118910 3:102209558-102209580 TTCCTGCCTCTGCCTTACAGTGG - Intronic
963140433 3:141942211-141942233 TTCCGGCCTCTCCCTGAGACAGG + Intergenic
964383836 3:156126325-156126347 GCACTGCCTCTTCTTGAGAGTGG - Intronic
964468733 3:157028387-157028409 TTCCTACCTCTTCCTGGGACTGG - Intronic
970061277 4:12037173-12037195 TTCTTGCCTCTTCATGGGACAGG + Intergenic
971364684 4:25968270-25968292 TGTCTGCCTCATCAAGAGAGAGG - Intergenic
972398183 4:38674828-38674850 TGCCTGCCCCTTCCTGAGGGAGG - Intronic
972941102 4:44196509-44196531 TTGTTTCTTCTTCATGAGAGCGG - Intronic
973135494 4:46700809-46700831 TTTCTGCTTCATCATGAGGGAGG - Intergenic
973832937 4:54780061-54780083 TTTCTGCCTCTTCTGGAGATAGG - Intergenic
974125822 4:57693958-57693980 TTCCTGCCTCTTTGTGAGGAAGG + Intergenic
977030344 4:91875296-91875318 TTCCTGGCTTGTGATGAGAGAGG - Intergenic
978859786 4:113434676-113434698 TTCATGCCCCTCCATGACAGGGG + Intergenic
979358365 4:119732256-119732278 TTCTTGCCTCTTCAGAAGAAAGG - Intergenic
980539535 4:134176584-134176606 TTGTTTCCTCTCCATGAGAGAGG - Intergenic
981216273 4:142172463-142172485 TTCCTCCCTTTTCACGACAGAGG + Intronic
983824280 4:172238215-172238237 TTTCTGCCTATTCATGAGCATGG + Intronic
984633684 4:182088381-182088403 TTCCTGCCTCTTGATAACACTGG - Intergenic
984785310 4:183562298-183562320 TTCCTGTCTCTCCACAAGAGAGG - Intergenic
984834786 4:184009830-184009852 TTCCAGTTTCTTCATGAGCGCGG - Exonic
987520097 5:18970710-18970732 TTTTTTCCTCTTCAGGAGAGAGG - Intergenic
988493348 5:31723962-31723984 TTCCTGCCTCTTCATGAGAGAGG - Intronic
991448210 5:66723027-66723049 TTTCTGCCTTTTCATCACAGTGG + Intronic
992097391 5:73375657-73375679 TTCCTGCTTGTTCTTGAGTGTGG - Intergenic
993371182 5:87094004-87094026 TTCATGCCTCTAGATGAGAGGGG + Intergenic
994678596 5:102857343-102857365 TTTATGGCTCTTCAAGAGAGTGG + Intronic
998005621 5:138655008-138655030 TTTCTGCCTCTTCCTCAGACTGG - Intronic
998533623 5:142908687-142908709 ACCCTGCCTCTCCATGGGAGGGG + Intronic
999833918 5:155348921-155348943 TTCCTGCTTCTGCATGAGCTTGG + Intergenic
1000209984 5:159099896-159099918 TTCCTGCTTCTTCAAGTGAAGGG - Intergenic
1002056098 5:176598680-176598702 ACCCTGCCTCCTCAGGAGAGGGG - Exonic
1002432431 5:179211277-179211299 CTCCTGCCTCTGCAGGAGATGGG - Intronic
1005490960 6:26346660-26346682 TTCCTGCTTTTTCTTGAGAAGGG - Intergenic
1005870422 6:29971131-29971153 TCCCTGCATCTCCATTAGAGGGG - Intergenic
1006439617 6:34045724-34045746 TTCCTGCCCACCCATGAGAGGGG - Intronic
1006937072 6:37725903-37725925 TTCCTGTCCCTGCAGGAGAGAGG + Intergenic
1009506611 6:64490127-64490149 ATCCTTCCTTTTCATGAAAGTGG + Intronic
1012551826 6:100470119-100470141 TTCCTGCCTCCTTAGGAAAGTGG + Intergenic
1013485205 6:110590110-110590132 TTCCTGTCTCTTCATGGCAGGGG - Intergenic
1015488205 6:133795785-133795807 TTCTTGCCTATTCATGAGCATGG + Intergenic
1019464811 7:1181745-1181767 TTCCTGCCTCTTCCTGATCGTGG - Intergenic
1020017790 7:4841589-4841611 TTTCTGCCTCTCCACTAGAGTGG - Intronic
1021865133 7:24948733-24948755 TTCTTCACTCTTCATGACAGAGG - Intronic
1023568501 7:41548762-41548784 TTCCTGTCTCTCCATAGGAGAGG + Intergenic
1023745042 7:43315369-43315391 TTCCTGCTTCTGCAAGAGAATGG + Intronic
1025247300 7:57327008-57327030 TTCCTGCCTCTTCGTAAGACTGG + Intergenic
1031393650 7:121246776-121246798 TTCATACCTGTTAATGAGAGAGG + Intronic
1032309115 7:130766061-130766083 ATTCTGCCTCTCCATGAGCGTGG + Intergenic
1036387413 8:8294444-8294466 TTCCGGGCTCGTGATGAGAGGGG - Intergenic
1037752339 8:21690996-21691018 TTCCAGCCTCTGCATGGAAGGGG - Exonic
1038330498 8:26604499-26604521 TGCCTGCCTCATCTTGAGAGAGG + Intronic
1042147743 8:65749090-65749112 TTCCCGCCTCTTCAAGATAGGGG - Intronic
1042568274 8:70134607-70134629 TGCCTGCCTCCTCCTGACAGTGG - Intronic
1042821851 8:72937736-72937758 TCCCTTTCTCTTCAAGAGAGAGG + Exonic
1042961765 8:74310936-74310958 TCCCTGCCTCTGAATGTGAGGGG + Intronic
1046130000 8:109954937-109954959 TTGTTTCCTCTCCATGAGAGTGG + Intergenic
1049064864 8:140305108-140305130 TACATGCCTGTTCTTGAGAGGGG + Intronic
1051344149 9:16137391-16137413 TTGCTGCCTCTTCATGACAAAGG - Intergenic
1052463664 9:28801018-28801040 TTACTGCCTGTTTCTGAGAGAGG - Intergenic
1052480368 9:29017547-29017569 TTGTTCCCTCTTCATGACAGTGG - Intergenic
1052665137 9:31486740-31486762 TTGTTTCCTCTCCATGAGAGAGG - Intergenic
1052747067 9:32451428-32451450 TTCCTGGGTCTCCATAAGAGTGG - Exonic
1053519215 9:38761338-38761360 TTCCTGTCTCATCAAGAGTGAGG - Intergenic
1056177192 9:84046223-84046245 TTGCTTCCTCTTCATGGGAGTGG + Intergenic
1057420456 9:94907982-94908004 TTCCTCACTTTTCCTGAGAGGGG + Intronic
1060836133 9:126756405-126756427 CTGCTGCCTGTTCATGACAGGGG - Intergenic
1185472099 X:390034-390056 TTCCTGCCTCGGCTGGAGAGCGG - Intergenic
1186335034 X:8577305-8577327 TTACTACCTCTTCAAGTGAGAGG + Intronic
1186620718 X:11237428-11237450 TTCCAGCCTCTTGAGGAAAGTGG + Intronic
1186642185 X:11467439-11467461 TTCCTGCCTTTGGTTGAGAGAGG - Intronic
1187261893 X:17692538-17692560 TTCCTGCCTCCCAGTGAGAGAGG + Intronic
1188812750 X:34672074-34672096 TTCCTTCTTTTTCATGAGGGAGG - Intergenic
1189660021 X:43286653-43286675 TTGATTCCTCTCCATGAGAGAGG + Intergenic
1189875736 X:45434106-45434128 TTCCTGCCATTTGAGGAGAGGGG - Intergenic
1190525723 X:51327688-51327710 GTGCTGCATCTTTATGAGAGAGG + Intergenic
1192718832 X:73670305-73670327 TTCATTCCTCTCCTTGAGAGTGG + Intronic
1192763410 X:74119382-74119404 TTCGTGACTCTCCATGGGAGTGG - Intergenic
1194888564 X:99349046-99349068 TTGTTTCCTCTTCATGAGAGTGG + Intergenic
1196461434 X:115935807-115935829 TTCCTTCTGCTTGATGAGAGAGG - Intergenic
1196599490 X:117585382-117585404 ACTCTGACTCTTCATGAGAGGGG + Intergenic
1197089790 X:122523096-122523118 TTATTTCCTCTCCATGAGAGTGG - Intergenic
1197717317 X:129718884-129718906 AGGCTGCCCCTTCATGAGAGAGG - Intergenic
1199711563 X:150473315-150473337 TGCCTCCCTCTTCTGGAGAGTGG + Intronic
1202088619 Y:21164704-21164726 GACATGCCTCTTCATGAGAGGGG + Intergenic
1202605367 Y:26635216-26635238 CTCCTGCCTTTTCCTGAGTGAGG - Intergenic