ID: 988494167

View in Genome Browser
Species Human (GRCh38)
Location 5:31730599-31730621
Sequence GTGTGTGTGTGTAAGGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7115
Summary {0: 2, 1: 8, 2: 69, 3: 735, 4: 6301}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988494163_988494167 30 Left 988494163 5:31730546-31730568 CCAGGAGTTTGTGTGTGTGTGTG 0: 1
1: 46
2: 647
3: 3719
4: 5434
Right 988494167 5:31730599-31730621 GTGTGTGTGTGTAAGGGAGTTGG 0: 2
1: 8
2: 69
3: 735
4: 6301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988494167 Original CRISPR GTGTGTGTGTGTAAGGGAGT TGG Intronic
Too many off-targets to display for this crispr