ID: 988496670

View in Genome Browser
Species Human (GRCh38)
Location 5:31751347-31751369
Sequence TAATTGCAAGGTCCCCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 92}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988496670_988496675 -8 Left 988496670 5:31751347-31751369 CCTTGCAGGGGACCTTGCAATTA 0: 1
1: 0
2: 0
3: 4
4: 92
Right 988496675 5:31751362-31751384 TGCAATTAAGAGGTCTAGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 113
988496670_988496678 3 Left 988496670 5:31751347-31751369 CCTTGCAGGGGACCTTGCAATTA 0: 1
1: 0
2: 0
3: 4
4: 92
Right 988496678 5:31751373-31751395 GGTCTAGGTGGGAAATGATGGGG 0: 1
1: 0
2: 3
3: 25
4: 281
988496670_988496676 1 Left 988496670 5:31751347-31751369 CCTTGCAGGGGACCTTGCAATTA 0: 1
1: 0
2: 0
3: 4
4: 92
Right 988496676 5:31751371-31751393 GAGGTCTAGGTGGGAAATGATGG No data
988496670_988496674 -9 Left 988496670 5:31751347-31751369 CCTTGCAGGGGACCTTGCAATTA 0: 1
1: 0
2: 0
3: 4
4: 92
Right 988496674 5:31751361-31751383 TTGCAATTAAGAGGTCTAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 85
988496670_988496679 4 Left 988496670 5:31751347-31751369 CCTTGCAGGGGACCTTGCAATTA 0: 1
1: 0
2: 0
3: 4
4: 92
Right 988496679 5:31751374-31751396 GTCTAGGTGGGAAATGATGGGGG 0: 1
1: 2
2: 14
3: 84
4: 469
988496670_988496677 2 Left 988496670 5:31751347-31751369 CCTTGCAGGGGACCTTGCAATTA 0: 1
1: 0
2: 0
3: 4
4: 92
Right 988496677 5:31751372-31751394 AGGTCTAGGTGGGAAATGATGGG 0: 1
1: 0
2: 0
3: 31
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988496670 Original CRISPR TAATTGCAAGGTCCCCTGCA AGG (reversed) Intronic
908564884 1:65344212-65344234 TTATTGTAAGGACCCCTGGAGGG - Intronic
913259851 1:116988160-116988182 TCATTTTAAGGTCCACTGCAGGG + Exonic
917789083 1:178488049-178488071 GAATTGCAGGCTCCTCTGCAGGG - Intergenic
922707365 1:227796458-227796480 TACCTGCAATGTGCCCTGCATGG + Intergenic
923198352 1:231689261-231689283 TAATTCTAAGGTCTCCTGAAGGG - Intronic
1064864702 10:19866675-19866697 TTATTGCATGGTCCCAAGCAAGG + Intronic
1065618669 10:27555871-27555893 TAAGTGCTAGGTCCCATGCTTGG + Intergenic
1067151156 10:43735928-43735950 TATGTGCAAGGTCCTCTGCCAGG - Intergenic
1071385455 10:85115110-85115132 TTCTTGCAAGTTTCCCTGCAAGG + Intergenic
1072200477 10:93153507-93153529 TAATTGCAAGGCCCCCATGATGG - Intergenic
1081840761 11:46199826-46199848 TCATTGCTAGGACCCCTCCAAGG - Intergenic
1086097199 11:83062436-83062458 TAAATGCAAGGTCCTGTGCTGGG - Intronic
1089515330 11:119028425-119028447 TAAGTGTAATGTTCCCTGCAGGG - Exonic
1090771393 11:129922697-129922719 TTATTTCTGGGTCCCCTGCAGGG + Intronic
1096516320 12:52157513-52157535 TAAGTGCCAGGTCCACTGCAAGG + Intergenic
1104132981 12:125912583-125912605 TGATTGCTAGGTACTCTGCATGG - Intergenic
1117516718 14:56509093-56509115 AAAATGCAAGTACCCCTGCAGGG + Intronic
1119570922 14:75671370-75671392 GAATTGCAAGGGACCCTGAATGG - Intronic
1121862421 14:97330750-97330772 TAACTGCAACCTCCCCTCCAGGG - Intergenic
1121879389 14:97486678-97486700 TTATTGCAAGTTCCTCAGCATGG - Intergenic
1122458311 14:101874063-101874085 TAATTGCTAGATCCCCTGGGTGG - Intronic
1122841299 14:104465039-104465061 ACATTGCATGGTCCCCAGCATGG - Intergenic
1125160413 15:36636740-36636762 TTATTGAAAGGTCCCCTTCCTGG - Intronic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1128204299 15:65837219-65837241 TAATAGCACCGGCCCCTGCAGGG + Intronic
1128457663 15:67841374-67841396 TGGTTGCAAGGTCCTCTGCCTGG - Intergenic
1132207290 15:99994965-99994987 TGGCTGCAATGTCCCCTGCAGGG + Intronic
1133893998 16:9908272-9908294 TAATTGCAAGGTCACCCTCTTGG + Intronic
1135979442 16:27135964-27135986 TTATTGCAGGGTGCCCAGCAAGG + Intergenic
1137785795 16:51136791-51136813 CAATTGCAAGTTGCCCTGCTAGG - Exonic
1138197438 16:55061857-55061879 TACTTGCAGAGTCCTCTGCAAGG - Intergenic
1139166636 16:64573476-64573498 TCACTGCAAGCTCCCCTGCCCGG + Intergenic
1141165581 16:81658768-81658790 TAGTTCCAAGGTCCCCTCCTGGG - Intronic
1141462172 16:84184110-84184132 TGACTGCAAGGTCTCCTGAATGG - Intronic
1148381173 17:47199164-47199186 TCATTGCAAGGTCCACTTCTGGG - Intergenic
1159345634 18:67199834-67199856 TCATTGCAAGGTGCCTGGCATGG - Intergenic
1159903840 18:74072660-74072682 TACTTGAAAGATCCCCTCCAAGG - Intergenic
925958643 2:8994419-8994441 TAATGGCAAGATCCCATGCGGGG - Intronic
926748583 2:16180456-16180478 AAATTTCAAAGGCCCCTGCAGGG - Intergenic
928015392 2:27651719-27651741 TATTTGCTAGGTCCTGTGCAAGG - Exonic
929761460 2:44810893-44810915 TAATTACAAGGGTCCCTGCTTGG + Intergenic
931443561 2:62308175-62308197 TAGATGCCAGGTGCCCTGCAAGG + Intergenic
934695916 2:96400067-96400089 TAATTGCAAGGTTGCCTGGGTGG - Intergenic
937679437 2:124627669-124627691 TGATTGCAACGTCTCCAGCAAGG + Intronic
943795454 2:191987215-191987237 TAATGCCAATGTCCCCTGAATGG + Intronic
946852491 2:223920637-223920659 TTATTGCAAGGTTTCCTGCAAGG - Intronic
947551247 2:231048348-231048370 TATTTGCTCGGTGCCCTGCAAGG + Exonic
947988400 2:234467881-234467903 GAATTCCACTGTCCCCTGCATGG - Intergenic
1170117886 20:12880578-12880600 GAATTGCAAGTTACCTTGCAAGG - Intergenic
1171060388 20:21951965-21951987 TATTTGCAAGCTATCCTGCAAGG - Intergenic
1172152267 20:32798782-32798804 GAATTGCCAGCTCCTCTGCACGG + Intronic
1174545491 20:51322210-51322232 CCATTGCAGGGTCCCCTGCCAGG + Intergenic
1174934887 20:54856547-54856569 TAACTGCAGGATCCCCTGAAAGG - Intergenic
1175714340 20:61245696-61245718 TGATTGCATGGACCCCTGCCCGG - Intergenic
1177416083 21:20794949-20794971 TTATTGCAAGGAACCCAGCAAGG - Intergenic
1181761205 22:25059940-25059962 TAAATGCCAGGCCTCCTGCAAGG + Intronic
1181863702 22:25839369-25839391 TAAATGCCAGGACTCCTGCAGGG - Intronic
1184735718 22:46396732-46396754 TTATTCCAAGGTACCCTGCAAGG + Exonic
1184992208 22:48178483-48178505 AAAGTGCAAGGTCTCCTGAAGGG + Intergenic
952086297 3:29825549-29825571 TAATGGGGAGTTCCCCTGCACGG + Intronic
956064054 3:65378552-65378574 TAATTGCAAGGGCCTCAGAATGG - Intronic
962382833 3:134911197-134911219 TGAGTGCAAGGTACTCTGCAAGG + Intronic
965129266 3:164673938-164673960 AAAATGCAGGGTCCCCTGCTGGG - Intergenic
967309142 3:188089586-188089608 TAACTGCAAGATCCCCTGATGGG - Intergenic
970291752 4:14580667-14580689 TAATTGAAAGAGGCCCTGCAAGG + Intergenic
971133859 4:23844997-23845019 TCATTGCAAGTTCCCCCTCAGGG - Intronic
973562378 4:52150048-52150070 TATTTGCAAGGTGCCAAGCAAGG + Intergenic
973843808 4:54890674-54890696 CAACTCCAAGGTCACCTGCATGG + Intergenic
984577645 4:181470460-181470482 TCATTGAAATGTACCCTGCAAGG + Intergenic
988445561 5:31282480-31282502 TAATTGCAAGGGTCCTTACAAGG - Intronic
988496670 5:31751347-31751369 TAATTGCAAGGTCCCCTGCAAGG - Intronic
996729462 5:126703345-126703367 TAATTGTAAGGTCCTCTGAGCGG - Intergenic
996891629 5:128427809-128427831 TTATTGCAGGGTGCCCAGCAGGG - Intronic
998415158 5:141940778-141940800 TGAGTGCAAGGCCCCATGCAGGG + Exonic
999264131 5:150255485-150255507 TAGCTGCTAAGTCCCCTGCAGGG - Intronic
1005120428 6:22383400-22383422 TCACTGCAAGGGCACCTGCATGG + Intergenic
1019514876 7:1435183-1435205 CAATGGCAAGGTGCCCTGGAGGG + Intronic
1021242857 7:18226317-18226339 CAACTGCAGGCTCCCCTGCAGGG + Intronic
1022975935 7:35557028-35557050 TATTTGCAATGGCTCCTGCATGG - Intergenic
1024570933 7:50722319-50722341 TGATAGAAAGGTCCCCTGGAAGG + Intronic
1027687832 7:81299656-81299678 TAATAGGAAGGTTCCCTTCATGG - Intergenic
1028014865 7:85695577-85695599 ACATTGCTAGGTCCTCTGCAAGG - Intergenic
1030290099 7:107863769-107863791 TAAATGCCAGGTCCCATGCTAGG + Intergenic
1038428331 8:27479751-27479773 CAAAGGCAAGGTCACCTGCAAGG - Intronic
1039744080 8:40408063-40408085 CTATTGCAAGGTCCCCAGCAGGG - Intergenic
1047176721 8:122548453-122548475 TAATTGAAAGGACCACTGAATGG - Intergenic
1048376814 8:133830007-133830029 CAATGGCAATGTCCACTGCATGG + Intergenic
1049093834 8:140536139-140536161 TAATTACAAGGTCACAAGCATGG + Intronic
1053906545 9:42849607-42849629 TAACTGCAACGTCCACTTCATGG + Intergenic
1055999885 9:82203719-82203741 TAATTGCAAGCTCCCACCCATGG + Intergenic
1056301688 9:85248964-85248986 GAAGAGCAAGCTCCCCTGCAGGG - Intergenic
1060604268 9:124899954-124899976 TAATTCTCAGGTCTCCTGCAAGG + Intronic
1061409221 9:130409628-130409650 TAAGTGCAAGGCCCCGTGCCTGG - Intronic
1190362702 X:49664531-49664553 CAATTGCAAGTTGCCCTGCTAGG - Intergenic
1192766700 X:74147002-74147024 TACTTGCACAGTCCCCAGCAGGG + Intergenic
1194434655 X:93855760-93855782 TAATTGGAGGGGCCCCTCCAAGG - Intergenic
1199576868 X:149320763-149320785 TAATTGCAAGGTTCTAAGCAAGG + Intergenic