ID: 988497558

View in Genome Browser
Species Human (GRCh38)
Location 5:31758040-31758062
Sequence AGATGAGCCCCGGCCTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988497558_988497563 7 Left 988497558 5:31758040-31758062 CCTGCCCAGGCCGGGGCTCATCT 0: 1
1: 0
2: 3
3: 28
4: 251
Right 988497563 5:31758070-31758092 ACGTCTCGCCTGACAGGCGCTGG No data
988497558_988497562 1 Left 988497558 5:31758040-31758062 CCTGCCCAGGCCGGGGCTCATCT 0: 1
1: 0
2: 3
3: 28
4: 251
Right 988497562 5:31758064-31758086 TTTTGTACGTCTCGCCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988497558 Original CRISPR AGATGAGCCCCGGCCTGGGC AGG (reversed) Intronic