ID: 988497558

View in Genome Browser
Species Human (GRCh38)
Location 5:31758040-31758062
Sequence AGATGAGCCCCGGCCTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988497558_988497563 7 Left 988497558 5:31758040-31758062 CCTGCCCAGGCCGGGGCTCATCT 0: 1
1: 0
2: 3
3: 28
4: 251
Right 988497563 5:31758070-31758092 ACGTCTCGCCTGACAGGCGCTGG No data
988497558_988497562 1 Left 988497558 5:31758040-31758062 CCTGCCCAGGCCGGGGCTCATCT 0: 1
1: 0
2: 3
3: 28
4: 251
Right 988497562 5:31758064-31758086 TTTTGTACGTCTCGCCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988497558 Original CRISPR AGATGAGCCCCGGCCTGGGC AGG (reversed) Intronic
900344204 1:2203387-2203409 AGCTGTGCCCAGGCCTGGGCAGG - Intronic
900609819 1:3539786-3539808 AGATAAGCCTGGGCCTGGGAAGG - Intronic
900658411 1:3771553-3771575 AGCTGGGCCCCGGCCTCTGCTGG - Exonic
900782455 1:4626876-4626898 AGAGGAGCCCAGGGCTGTGCTGG + Intergenic
901204927 1:7489160-7489182 AGGTGGGCCCTGGCCTGGGAAGG + Intronic
901250299 1:7772590-7772612 AGATGAGTACCTTCCTGGGCCGG + Intronic
902192555 1:14773805-14773827 AGAGCAGGCCTGGCCTGGGCTGG - Intronic
903140425 1:21335718-21335740 AGCTGAGCTCCTGCCTGGGGTGG + Intronic
903178341 1:21593423-21593445 AGATGACCGCAGGCCCGGGCCGG - Intergenic
903690132 1:25167508-25167530 AGCAGAGCCCGGGCCAGGGCTGG - Intergenic
905110887 1:35593629-35593651 AGGTGAGCCCCGTCCTGGCTAGG - Intronic
905404961 1:37726445-37726467 AGATGGGTCCCAGGCTGGGCGGG - Intronic
907476038 1:54706282-54706304 AGATAAGCCCTGGCCTGTGGGGG + Intronic
917854736 1:179091204-179091226 AGATCAGCCCTGGCAGGGGCTGG + Intronic
918475175 1:184917128-184917150 AAATGAGCCCCAGCCTGGGCTGG + Intronic
919518039 1:198551100-198551122 AGATGAGCCCAGCCCTGCTCTGG - Intergenic
920541023 1:206778074-206778096 AGAGGAGCCCGGGCTGGGGCTGG + Intergenic
922240988 1:223755439-223755461 AGAGGAGCCCAGCCCTGAGCAGG - Intronic
922763740 1:228147281-228147303 AGCTGAGCCTAGGCCTGGCCTGG - Intronic
923541510 1:234891353-234891375 AGATGAGCCCCGAGCTGGGCTGG + Intergenic
1065093927 10:22262654-22262676 ACATGGGCCCAGGCCTGGGGAGG + Intergenic
1065343040 10:24723834-24723856 AGCTGGGCCCCGGCCCGGCCCGG - Intergenic
1066264903 10:33767035-33767057 AGATGAGCCAAGGACTGGGTGGG + Intergenic
1067084045 10:43228921-43228943 AGCTGAGCCCCGGCCAGCCCTGG - Intronic
1067148124 10:43708462-43708484 AGACGAGGCCCGACCTGGGGGGG - Intergenic
1068669497 10:59709477-59709499 ACCTGAGTCCCGGCCTCGGCGGG + Exonic
1070642621 10:78180531-78180553 AGGTCAGCCCCGGCCAGAGCAGG + Intergenic
1073330945 10:102669515-102669537 AGGTGGGCCTGGGCCTGGGCTGG + Intergenic
1073547703 10:104365760-104365782 AGATGAGCCCTGACCATGGCAGG - Intronic
1074594578 10:114849789-114849811 AGATGAGCGGCTGCCAGGGCTGG - Intronic
1074712336 10:116187868-116187890 AGCAGAGCCCTGGCCAGGGCTGG + Intronic
1075659945 10:124186475-124186497 AGATGAGCATTGGCCTGGCCTGG + Intergenic
1076497129 10:130904615-130904637 AGATGGGCCCTGGCCTGGAGGGG - Intergenic
1076992770 11:284399-284421 AGGTGAGGCCTGGCCTGGGAGGG + Exonic
1077097483 11:805158-805180 AGGTACGCGCCGGCCTGGGCGGG - Exonic
1077244465 11:1529501-1529523 AGGTGAGCGTCGGCCTGTGCAGG - Intergenic
1077535537 11:3122327-3122349 AGGTGAGCCCGGGCCCGGGGAGG - Exonic
1077635814 11:3840873-3840895 AGGTGAGGCCCGGCCGGGGCTGG - Exonic
1077908935 11:6557865-6557887 AGTTGAGCCCCCACCTGGCCCGG + Exonic
1078823369 11:14905136-14905158 AGAAGACCCCCCGCCTGGCCAGG - Intronic
1079080912 11:17413166-17413188 AGAAGATCCCCAGCCTGGGAGGG + Intronic
1081809719 11:45908012-45908034 AGCTGAGCCCAGGCCTGCGAGGG - Intergenic
1084461408 11:69298550-69298572 ACATGAGACCTGACCTGGGCTGG - Intronic
1084526343 11:69700777-69700799 AGCTGGGCGCCGGCCTGGCCTGG - Intronic
1090955838 11:131512398-131512420 AGGACAGCCCCTGCCTGGGCTGG - Intronic
1095289867 12:40465551-40465573 AGGTGAGCCCGGGCTTGGCCTGG - Exonic
1095363587 12:41374262-41374284 AGATAAGCCCCTTCCTGGGAAGG + Intronic
1097194243 12:57235085-57235107 AAAGGTGCCCCAGCCTGGGCAGG + Exonic
1100260418 12:92928506-92928528 TGGTGAGCCCCGGCCTAGCCTGG - Intronic
1101965945 12:109281852-109281874 ATTTGAACCCAGGCCTGGGCTGG - Intronic
1102348518 12:112175045-112175067 AGCTGTGCCCCTGCCTGGGAAGG + Intronic
1102484440 12:113246540-113246562 AGATGAGCAGCAGCGTGGGCAGG - Intronic
1103562537 12:121800122-121800144 AGATGAGCCGCCGCCCGGGCCGG - Intronic
1103930049 12:124445273-124445295 GGATGGGCCCCACCCTGGGCAGG - Intronic
1104220046 12:126774055-126774077 AGATCAGGCCCGGGATGGGCTGG - Intergenic
1104760754 12:131296527-131296549 AGATGATGCCCAGCCTGGGAAGG + Intergenic
1104819019 12:131664265-131664287 AGATGATGCCCAGCCTGGGAAGG - Intergenic
1104891106 12:132140599-132140621 AGGTGAGGCCCCGGCTGGGCGGG - Exonic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1113601613 13:111573367-111573389 AGATGAGCCCCAGCCGGGGAGGG + Intergenic
1113708913 13:112451707-112451729 AGAGGTGCTCGGGCCTGGGCTGG + Intergenic
1113849974 13:113412553-113412575 AGCAGAGCCCCTGCATGGGCGGG + Intergenic
1118978379 14:70696671-70696693 GGATGATACCTGGCCTGGGCTGG - Intergenic
1120834487 14:89027541-89027563 GGATGAGCCCCGGGCGTGGCTGG - Intergenic
1123706622 15:22955491-22955513 AGAGTTGCCCCGGCGTGGGCAGG + Intronic
1123994926 15:25711818-25711840 AGAGGCTCCCCGGCCTGGGCAGG + Intronic
1124210670 15:27762530-27762552 AGATAAGCCCCTCCCTGGGTGGG - Intronic
1125420399 15:39498929-39498951 AGATGTGCTCCAGGCTGGGCTGG + Intergenic
1125730442 15:41890030-41890052 AGGTGAGGCCAGGGCTGGGCTGG + Intronic
1125756597 15:42069546-42069568 AGAAGGGGCCCAGCCTGGGCTGG + Intronic
1129261685 15:74372100-74372122 ACATAAGCCCTGGCCCGGGCAGG - Intergenic
1129691826 15:77718104-77718126 ATGTGAGCTCAGGCCTGGGCTGG - Intronic
1129824619 15:78626452-78626474 AGATGAGAAGCGGCGTGGGCTGG + Intronic
1132570994 16:643921-643943 AGAGGAGCCCTGGGCAGGGCAGG + Intronic
1132689328 16:1175463-1175485 TGCTGGGCCCTGGCCTGGGCTGG + Intronic
1132775047 16:1588856-1588878 GGATGAGCCCTGGCCTGGCAGGG + Intronic
1133732762 16:8590447-8590469 AGCTGCGCCCCGGCCAGAGCAGG - Intergenic
1135548040 16:23378766-23378788 AGGTGAGCCTGAGCCTGGGCGGG + Exonic
1135725425 16:24850443-24850465 AGCTGTGCCCTGGCCTGGCCTGG - Intronic
1136267588 16:29130526-29130548 GGAGGGGCCCAGGCCTGGGCGGG - Intergenic
1138090883 16:54173651-54173673 AGAAGAGCCGCAGCCTGGGCTGG + Intergenic
1138092036 16:54182676-54182698 AGAAGAGTCCTGGGCTGGGCAGG + Intergenic
1139923896 16:70475253-70475275 GGATGAGTCCCGCACTGGGCTGG + Intronic
1141899119 16:86978840-86978862 AGATGAGGGCAGGGCTGGGCTGG + Intergenic
1141953226 16:87352870-87352892 AGATGTGCCGGCGCCTGGGCCGG - Intronic
1142030520 16:87836189-87836211 TGGTGAGCCCCGGCAGGGGCGGG - Intronic
1142167078 16:88597822-88597844 AGATGAGCCTGGGCCAGGGCTGG + Intronic
1142292570 16:89199751-89199773 AGGTGAGCCACCTCCTGGGCTGG - Exonic
1142699234 17:1649386-1649408 AGCGCAGCCCCGGCCAGGGCAGG - Intronic
1143730603 17:8880691-8880713 AGATCAGGTGCGGCCTGGGCCGG + Exonic
1144775403 17:17782502-17782524 AGATGCGCCCGGTCCTGGGGAGG - Intronic
1144816692 17:18039901-18039923 AGGTGAGCGCCGGGCCGGGCCGG + Exonic
1145014570 17:19387828-19387850 AGAGGGGCCCTGGCCTGAGCTGG - Intergenic
1145787826 17:27605508-27605530 AGATGGGGCCCCGCCAGGGCCGG - Exonic
1146627273 17:34444132-34444154 AGAGGAGCCCCGGCTTGGGGAGG + Intergenic
1147144946 17:38479370-38479392 GGATGAGCCCTGGGGTGGGCTGG + Intronic
1147240017 17:39084709-39084731 AGCTGGGGCCCAGCCTGGGCAGG + Intronic
1147424853 17:40341687-40341709 AAATGAGGCCCGGCCTGGGTGGG + Intronic
1147659951 17:42112092-42112114 AGGTGAGTCCTGGGCTGGGCAGG - Exonic
1148128284 17:45247883-45247905 AGACACGCCCCGGGCTGGGCGGG + Intergenic
1148331663 17:46817375-46817397 AGGAGAGCCTTGGCCTGGGCGGG - Intronic
1148340840 17:46872572-46872594 AGGTGGGCCCCGCCCTGTGCCGG - Exonic
1149141410 17:53436983-53437005 AGATGTGCACTGGGCTGGGCAGG - Intergenic
1149649937 17:58270557-58270579 AGATGAGCCCAGCCCTGTTCTGG - Exonic
1149690194 17:58568996-58569018 AAATGAGCCACAGCCTGGCCAGG - Intronic
1150487605 17:65554754-65554776 AGATGAGCCCCACCTTGGGCAGG + Intronic
1150917142 17:69448555-69448577 AAAAGAGCCCTGGCCAGGGCCGG - Intronic
1151678907 17:75613871-75613893 AGAGGTGCCCCGGGGTGGGCAGG + Intergenic
1151828272 17:76535629-76535651 AGAGGGGCCTGGGCCTGGGCTGG - Intronic
1152144704 17:78561323-78561345 AGGGGAGCCCCGGCTTGGCCTGG - Intronic
1152756379 17:82088731-82088753 AGACGAGACCCGGGCTGGGAAGG + Intronic
1152930106 17:83104988-83105010 AGGTGAGCCCCCGCCTGGACCGG - Intergenic
1153666471 18:7371101-7371123 AGTAGGGCCCTGGCCTGGGCAGG + Intergenic
1154405886 18:14090662-14090684 AGGGGAGCCCCTTCCTGGGCTGG + Intronic
1156248167 18:35323249-35323271 AGATAAGCCCCTCCTTGGGCAGG - Intergenic
1156562786 18:38147504-38147526 AGATGTGCCTCTTCCTGGGCTGG + Intergenic
1157389577 18:47289878-47289900 AGAGGAGAGCCTGCCTGGGCGGG - Intergenic
1160044375 18:75373099-75373121 AGGTGAGCCCAGGCCTGCTCAGG + Intergenic
1160157645 18:76445775-76445797 GGAGGAGCCCAGGCCTGGTCAGG + Intronic
1160765584 19:806170-806192 AGATGAGCCCAGGCCCGGCCCGG + Intronic
1160806501 19:994425-994447 AGGAGAGTCCAGGCCTGGGCTGG - Exonic
1160823739 19:1069746-1069768 AGCTGAGCCCCGCCCAGGCCAGG - Intronic
1160932962 19:1579256-1579278 AGGTGACCCCCGGCCTGCGAGGG - Intronic
1161072916 19:2271250-2271272 GGGTGGGCCCCTGCCTGGGCGGG + Intronic
1161361423 19:3852182-3852204 AGCTGAGCCCCGCCTTGGCCAGG - Intronic
1161422189 19:4182138-4182160 ATTTGAGCCCCGTCCTGGCCCGG + Intronic
1161663702 19:5562315-5562337 AGGTGAGCCCTGGCAGGGGCAGG - Intergenic
1161778916 19:6278996-6279018 AGAGGAGCTCAGGCCAGGGCTGG + Intronic
1163596177 19:18222251-18222273 AGTCCAGCCCTGGCCTGGGCCGG - Exonic
1163676849 19:18659739-18659761 AGATGAGGCCAGCCCGGGGCCGG + Intronic
1163703450 19:18798782-18798804 ACAGGAGCCCAGGCCAGGGCCGG + Intergenic
1165063825 19:33217954-33217976 AGAGGGGCCCAGGCCTGGGTGGG + Intronic
1165487974 19:36106911-36106933 AGATGGGCCTAGGCCTAGGCAGG - Intergenic
1165741126 19:38205956-38205978 ATGTGTGCCCCGGCCTGGCCTGG + Intronic
1165939425 19:39407801-39407823 CGAGGAGCCCCAGCCTGGGCTGG - Exonic
1166347592 19:42176183-42176205 AGAGGCTCCCCGGGCTGGGCGGG - Intronic
1166538797 19:43592522-43592544 AGCAGTGCCCCTGCCTGGGCTGG + Exonic
1167117116 19:47494779-47494801 ACAGGAGCCCCGGCCTGGGTGGG + Intronic
1167152740 19:47719256-47719278 AGATGAGGCAGAGCCTGGGCAGG + Intronic
1168294125 19:55370405-55370427 AGCTGGGCCGCGGCCTGGGGAGG + Intronic
925814668 2:7735962-7735984 GGATGAGCCACAGCCTGGGAGGG - Intergenic
926684618 2:15689485-15689507 TGAGGAGCCCCACCCTGGGCTGG - Intergenic
926718213 2:15941062-15941084 AGAAGAACCCCAGCCTGGGGTGG - Intronic
927949627 2:27158881-27158903 AGCTCAGCCCCGGCCTGGGCCGG - Intergenic
931566812 2:63622901-63622923 CGCCGAGCCCCGGCCTGGCCCGG - Intronic
935217187 2:100983542-100983564 AGAAGAGCCCCGCCCTGGACAGG + Intronic
936484395 2:112914035-112914057 AGATGAGCCCGGGGAGGGGCAGG + Intronic
937189990 2:120085957-120085979 AGGTGAGCCCCTGCCTTGGTGGG - Intronic
938211076 2:129466104-129466126 AGAGCAGCCCCAGCCTGAGCTGG - Intergenic
941089661 2:161160297-161160319 AGAAGAGCCCTGGGCTGGGTGGG + Exonic
944626644 2:201576476-201576498 AAAGGAGCCCTGGTCTGGGCTGG - Intronic
946196081 2:218033707-218033729 AGACTAGCACCGTCCTGGGCTGG + Intergenic
946382488 2:219358518-219358540 GGAAGAGCCCAGTCCTGGGCCGG - Intergenic
946622470 2:221573657-221573679 CGATGAGCTGCGGCCGGGGCTGG - Intronic
949014659 2:241702409-241702431 AGATGAGGCGGGGCCTGGGTAGG - Intronic
1169111905 20:3039652-3039674 TGAGGAGCCCAGGCCTGCGCTGG - Intergenic
1170585037 20:17728162-17728184 GGCTGAGCCCCAGCCTGGGGTGG - Intronic
1172389800 20:34559021-34559043 GGACCAGCTCCGGCCTGGGCGGG + Intronic
1172429351 20:34876822-34876844 GGGTGAGGCCCGGCCCGGGCGGG + Exonic
1172852094 20:37973803-37973825 AGATGAGCTAGGGCATGGGCGGG + Intergenic
1173219968 20:41124602-41124624 AGATGAGGCAGGGCCTGGCCTGG + Intergenic
1173864757 20:46307031-46307053 AAATGAGCCGCTGCCTGTGCTGG + Intronic
1174569717 20:51492830-51492852 AAGTGAGCGCCGGCCGGGGCTGG + Intronic
1175403214 20:58712222-58712244 GGATGAGCCTGGGCATGGGCTGG - Intronic
1175428335 20:58885143-58885165 CCATGAGCCCCAGCGTGGGCAGG - Intronic
1175806881 20:61834399-61834421 AGCTTAGACCCTGCCTGGGCTGG - Intronic
1175959879 20:62630648-62630670 AGAGGAGACCCGCCGTGGGCAGG + Intergenic
1176140611 20:63543174-63543196 CGATGCTCCCAGGCCTGGGCAGG + Intronic
1180007898 21:45031701-45031723 CGATGAGCCCCCGCCCTGGCTGG - Intergenic
1180064047 21:45404264-45404286 AGATGAGCCCTGGCCGGGAAGGG + Intergenic
1180159914 21:45994389-45994411 GGGTGAGGCGCGGCCTGGGCCGG + Intronic
1180984035 22:19893585-19893607 ACCTGTGCCCAGGCCTGGGCCGG - Intronic
1181028910 22:20140707-20140729 CGGTGAGGCCCGGCCTGGGCAGG + Exonic
1181456680 22:23063881-23063903 AGGTGAGGCCTGGCCTAGGCTGG - Exonic
1181510445 22:23386535-23386557 GGAGGAGCCTGGGCCTGGGCAGG + Intergenic
1181745078 22:24950556-24950578 AGCTGACACCCGGTCTGGGCTGG + Intergenic
1182844430 22:33418770-33418792 GGATGGGAGCCGGCCTGGGCTGG - Intronic
1183675915 22:39298751-39298773 AGGTGAGTCCCTGCCAGGGCAGG + Intergenic
1184034268 22:41911090-41911112 AAATGAGCCGCGGCCTCTGCGGG - Intronic
1184219231 22:43088631-43088653 AGATGGGCCCCGGCCGGGCACGG - Intronic
1184222822 22:43111419-43111441 AGGTGCGCCCCAGACTGGGCGGG + Intronic
1184355783 22:43978729-43978751 AGAGGAGCCCCAGGCTGGGAGGG + Intronic
1184412092 22:44331469-44331491 AGCTGAGCCCCGGGGCGGGCAGG - Intergenic
1184918184 22:47587591-47587613 TGAGGAGCCCCGTCTTGGGCAGG - Intergenic
1185370777 22:50459931-50459953 AGGTGAGGGCCGGCCAGGGCTGG - Exonic
950465819 3:13153131-13153153 AGAGGAGCCCTAGCCTGGCCTGG - Intergenic
950676065 3:14555162-14555184 TGCTGAGCCCCAGCCTGTGCCGG - Intergenic
953792491 3:45958968-45958990 AGATGAATCTCGGGCTGGGCTGG - Intronic
954127035 3:48537405-48537427 AGCTCAGGCCCGGCCTGGGCTGG + Intronic
954194752 3:48990050-48990072 AGAGAAGCCCCAGCGTGGGCTGG + Exonic
954706403 3:52483081-52483103 AGGAGAGCAGCGGCCTGGGCAGG + Intronic
960356083 3:116655274-116655296 TGATGAGTCCTGCCCTGGGCTGG + Intronic
961567328 3:127773075-127773097 AGCTGGGCTCCAGCCTGGGCTGG + Intronic
961701305 3:128746817-128746839 AGTTGAACCCCGGCCGGGCCGGG - Intronic
962876796 3:139541412-139541434 AGATGAGCCCTGGGCTGGCTAGG - Intergenic
968953380 4:3706247-3706269 AGGTGGGCCCCGTGCTGGGCTGG + Intergenic
968961785 4:3749214-3749236 AACTGAGCCCCGCCCTGGGTAGG + Intergenic
969182666 4:5454137-5454159 AGATGGGGCCCGGCATGAGCGGG - Intronic
969228529 4:5814441-5814463 AGATCAGCACCGCCCTGGCCAGG - Intronic
969810071 4:9640807-9640829 AAATGAGCCACGAACTGGGCTGG - Intergenic
970332505 4:15001861-15001883 ACAGGACCCCCGGGCTGGGCCGG + Intergenic
971910419 4:32788889-32788911 AGCTGAGATCCAGCCTGGGCTGG + Intergenic
980164989 4:129214999-129215021 ACATGAACCCAGGCCTGCGCAGG - Intergenic
982067157 4:151664409-151664431 ACAGGAGACCTGGCCTGGGCAGG + Intergenic
984260793 4:177442131-177442153 GGAAGAGCGCCGGGCTGGGCCGG - Intronic
985115965 4:186591107-186591129 AGGTTAGCCAGGGCCTGGGCAGG - Intronic
986354225 5:6908068-6908090 ATATGAGCCCAGGGCTTGGCAGG - Intergenic
988497558 5:31758040-31758062 AGATGAGCCCCGGCCTGGGCAGG - Intronic
990382861 5:55233246-55233268 AGCTGCGCCACGGGCTGGGCCGG + Exonic
993499574 5:88649866-88649888 AAATGTGCTCCAGCCTGGGCAGG - Intergenic
995208469 5:109509724-109509746 TGGAGAGCCCAGGCCTGGGCTGG + Intergenic
997199906 5:132003593-132003615 AGAACAGCCCCAGCCTGGCCAGG - Intronic
997470637 5:134115154-134115176 AGGTGAGCCCCCGCCGGCGCCGG + Exonic
998349693 5:141492523-141492545 ACCTGCGCCCCGGGCTGGGCCGG + Intronic
1000662019 5:163949221-163949243 CGTTGATCCCCTGCCTGGGCAGG - Intergenic
1001083193 5:168681784-168681806 AGCTGAGCCCTGCCCTGAGCTGG - Intronic
1001342801 5:170862508-170862530 AGTTGAGCCCCAGCCGGAGCGGG + Intronic
1002281059 5:178130545-178130567 AGGTGCGCACCGGCCTCGGCAGG - Intergenic
1002337085 5:178487224-178487246 AGGGAAGCCCTGGCCTGGGCTGG - Intronic
1002773310 6:307611-307633 AGAGCAGCCCCTCCCTGGGCCGG + Intronic
1002921310 6:1575285-1575307 AGAGGAGGCCTGGCCAGGGCAGG - Intergenic
1003498752 6:6687073-6687095 AGATGAGGCCTGGAATGGGCGGG - Intergenic
1003498774 6:6687146-6687168 AGATGAGGCCTGGAATGGGCGGG - Intergenic
1003963295 6:11229361-11229383 CGCTGAGCCCCCGCCCGGGCTGG + Intronic
1004005344 6:11632840-11632862 AGCTGAGAGCAGGCCTGGGCTGG + Intergenic
1004779144 6:18886475-18886497 ACATGAACCCAGGCCTGTGCAGG - Intergenic
1005687308 6:28267229-28267251 AGCTGGGCCCCGGGCTGGGGCGG + Intronic
1006334894 6:33415321-33415343 AGAGGAGCACTGACCTGGGCAGG - Exonic
1006764737 6:36494875-36494897 AGGAGAGCCCAGGCCTAGGCAGG - Exonic
1007581168 6:42960972-42960994 GGGTGAGCCCAGGCCGGGGCCGG + Exonic
1007686613 6:43670841-43670863 AGGTGAGGCCCGGCCAGAGCAGG - Exonic
1008511174 6:52277110-52277132 AGAGGAGCCCCGGCCAGTGGTGG + Exonic
1012379386 6:98601959-98601981 AGAGGAGACCCGCCCTGGTCTGG - Intergenic
1013298340 6:108780297-108780319 AGAGGAGCCGAGGGCTGGGCTGG + Intergenic
1014972711 6:127837303-127837325 TCATGAGCCCCGGCATGGGTAGG - Intronic
1017409505 6:154153391-154153413 AAAAGAGCCCCGGCCAGGACCGG + Intronic
1019304663 7:327562-327584 AGAAGAGCCCCTGGCTGGGCTGG - Intergenic
1019428159 7:987023-987045 AGTGGAGCCCAGGGCTGGGCTGG + Intronic
1019473105 7:1231611-1231633 AGGAGAGCTCCGGCCTGGGCTGG - Intergenic
1019550733 7:1601172-1601194 AGCTGAGCCCCACCCTGGACTGG - Intergenic
1020123102 7:5516656-5516678 AGATGAGCCCTGGCCGGGTGCGG - Intergenic
1020371702 7:7439177-7439199 AGATGAACACGGCCCTGGGCAGG - Intronic
1022506647 7:30911834-30911856 AGCTGAGCCACAGCCTGGGCTGG - Exonic
1023103603 7:36742982-36743004 AGAGGAAACCAGGCCTGGGCTGG - Intergenic
1023623512 7:42095324-42095346 AGATGAGGCCAGGCCTGTTCAGG + Intronic
1023941143 7:44769036-44769058 GGATGAGCCCCTGGCTGGGCTGG - Exonic
1026149091 7:67772931-67772953 AGATGGGACCCTGCCTGGGCTGG - Intergenic
1026553188 7:71385293-71385315 AGATGACTGCCGGGCTGGGCAGG - Intronic
1028856155 7:95596418-95596440 TTGTGCGCCCCGGCCTGGGCTGG + Exonic
1029058389 7:97771067-97771089 AAATGAGCTCCTTCCTGGGCGGG + Intergenic
1034982664 7:155488750-155488772 AGCTGAGTCCAGGCCTGGGGTGG - Intronic
1036557955 8:9876498-9876520 AGGTGAGCCCCAGCCTGGGATGG - Intergenic
1037242924 8:16797825-16797847 GGATGAGCCACATCCTGGGCTGG + Intergenic
1037891070 8:22624022-22624044 AGAGGAGCTGCGGCCTGTGCGGG - Exonic
1037917516 8:22781572-22781594 AAATGATCCAAGGCCTGGGCGGG + Intronic
1037981821 8:23259763-23259785 AGATGAGCCCCAGGGAGGGCAGG - Intronic
1038411069 8:27360404-27360426 AGAGGAGGCCTGGCCTGGGCAGG + Intronic
1049465440 8:142749307-142749329 AGATGGGCCCCAGCCTGGCTAGG - Intergenic
1049530298 8:143151166-143151188 AGAAGAGCCCCGTCCAGGGAAGG - Intergenic
1049618867 8:143588914-143588936 GGAGGAGCCCCAGCCTGGGATGG + Intronic
1052028018 9:23596178-23596200 AGAGGTGCCCCGGCAGGGGCGGG - Intergenic
1052380293 9:27763510-27763532 AGAAGAGCTCGGGCCGGGGCGGG + Intergenic
1052932394 9:34066442-34066464 ACATGAGCCACTGCCTGGCCTGG - Intergenic
1057312022 9:93948780-93948802 AGAAGGGCCCCGGCCCGGGATGG - Intergenic
1057877075 9:98765987-98766009 CTATGAGCCCCGGACTGGGCTGG + Intronic
1060213596 9:121725100-121725122 AGAGGAGCTCAGGCCTGGCCCGG + Intronic
1061709620 9:132478635-132478657 AGATGGGGCCCGGCGTGGGCTGG + Intronic
1061874817 9:133538423-133538445 AGGTGAGGCCCGGCCCGGGCAGG + Exonic
1062004803 9:134233790-134233812 ATATGAGCCAGGGTCTGGGCTGG + Intergenic
1062035163 9:134379703-134379725 ACCTGAGGCCCAGCCTGGGCGGG + Intronic
1062123367 9:134846374-134846396 AGAGGGGCCCCAGCCTGGTCTGG + Intergenic
1062364383 9:136202035-136202057 ACAGGAGCCCCCGCCAGGGCTGG - Intronic
1062464667 9:136675731-136675753 ACATCAGCCCCAGGCTGGGCAGG + Intronic
1062469116 9:136694595-136694617 TGATGAGCGCTGGGCTGGGCGGG + Intergenic
1062490675 9:136803473-136803495 AGGTGACCCCCGCCCTGGCCCGG - Intronic
1062732687 9:138118696-138118718 TGGGGAGCCCCAGCCTGGGCTGG + Exonic
1192107015 X:68326735-68326757 GGATCAGCCCCTGCCTGGCCAGG + Intronic
1192181792 X:68920774-68920796 AGCTGAGCCCAGGCCGGGGCTGG + Intergenic
1192195677 X:69026336-69026358 ATGTGAGCCTTGGCCTGGGCTGG + Intergenic
1192368142 X:70492143-70492165 AGCTGAGCCCCTGGCTTGGCAGG - Exonic
1195326911 X:103765578-103765600 AGATGAGCCATGAACTGGGCTGG + Intergenic
1197749913 X:129957280-129957302 GGAGGAGCCGGGGCCTGGGCAGG - Intergenic
1197756219 X:129996897-129996919 ACATGAGCCCATGCCTGGCCTGG + Intronic