ID: 988501103

View in Genome Browser
Species Human (GRCh38)
Location 5:31784448-31784470
Sequence CACAGTGATCTTGTGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 294}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988501099_988501103 26 Left 988501099 5:31784399-31784421 CCAAGGTAAGACATTGTCCTTGA 0: 1
1: 0
2: 1
3: 14
4: 137
Right 988501103 5:31784448-31784470 CACAGTGATCTTGTGGAGGATGG 0: 1
1: 0
2: 5
3: 21
4: 294
988501100_988501103 9 Left 988501100 5:31784416-31784438 CCTTGAATGCACGTAGAAAACAA 0: 1
1: 0
2: 1
3: 15
4: 155
Right 988501103 5:31784448-31784470 CACAGTGATCTTGTGGAGGATGG 0: 1
1: 0
2: 5
3: 21
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988501103 Original CRISPR CACAGTGATCTTGTGGAGGA TGG Intronic
900574991 1:3378661-3378683 CACAGAGACCCTGGGGAGGAAGG + Intronic
900939877 1:5791849-5791871 CACAGTGATGGTGTGAAGCAGGG - Intergenic
901650260 1:10739144-10739166 CCCAGGCATCTTGTGGAGGGTGG + Intronic
902391213 1:16108085-16108107 CACACTGATGATGAGGAGGAAGG - Intergenic
902965496 1:19998119-19998141 CACACTGATGATGCGGAGGAAGG + Intergenic
903165033 1:21514337-21514359 CACAGGGCTCTTGGGGAGCAAGG - Intronic
903420359 1:23214635-23214657 CAGGGTGATGTGGTGGAGGAGGG - Intergenic
904324190 1:29717147-29717169 CACACTGATGTTGAGGAGGAAGG - Intergenic
904675661 1:32197920-32197942 CACCGTGATGGGGTGGAGGAGGG - Exonic
905149339 1:35914904-35914926 AACAGTGTTCTTGTGGTTGATGG - Intronic
905509593 1:38508323-38508345 CACAGCAAGCTTCTGGAGGAAGG - Intergenic
905530957 1:38678297-38678319 CACTCTGATCTTGTGGTGGATGG - Intergenic
908354377 1:63316878-63316900 CCCAGTGGTCTTGGGCAGGAAGG + Intergenic
911142193 1:94516560-94516582 GCCAGTGATCATGTGAAGGAGGG + Intronic
915179757 1:154048048-154048070 CACACTGATGATGTGGAGGAAGG + Intronic
915296617 1:154925907-154925929 CACAGTGATCTAGGGCAGGAAGG + Intronic
915456272 1:156042864-156042886 CTCAGAGATCTGCTGGAGGAGGG + Exonic
917799715 1:178559750-178559772 CACACTGATAATGAGGAGGAAGG - Intergenic
918861513 1:189832180-189832202 CACAATCATCTTCTTGAGGAGGG + Intergenic
920096143 1:203487729-203487751 CACAGTGTTTTTGTGGGGGCGGG + Exonic
921263737 1:213405565-213405587 CACAGGGATCTTGTTGAAAATGG - Intergenic
921563718 1:216690465-216690487 CACAGTGGTTTTCTGGAGCAAGG + Intronic
922063945 1:222117856-222117878 GACAGGGATCTGGTGAAGGAGGG - Intergenic
922657828 1:227401536-227401558 CACAGGGATCTTTGGGAGGGTGG + Intergenic
922791251 1:228312297-228312319 CACAGTGAGCCTGTGGAGAGTGG - Intronic
924765152 1:247025345-247025367 CACACTGATGATGAGGAGGAAGG + Intergenic
1063096502 10:2913319-2913341 CGCAGTCATCTGATGGAGGAGGG + Intergenic
1063248288 10:4246930-4246952 AACAATGATGTTGTTGAGGATGG - Intergenic
1064112333 10:12550023-12550045 CACAGGGATTCTGTAGAGGAAGG + Intronic
1066990638 10:42510034-42510056 CACACTGATGTGGAGGAGGAAGG - Intergenic
1067961928 10:50864072-50864094 CACTGTTATCTAGTTGAGGATGG + Exonic
1068166675 10:53340295-53340317 CACACTGATGATGAGGAGGAAGG - Intergenic
1068556022 10:58459896-58459918 CATAGTGAACTTGTGGAGAACGG + Intergenic
1068764491 10:60748029-60748051 CACATTGATCTTTTGGAGAAAGG + Intergenic
1071144715 10:82554993-82555015 CACAGTGAGGGAGTGGAGGAAGG - Intronic
1072893050 10:99342053-99342075 AAGAGTGATTTTGTGGAGAACGG - Intronic
1073324687 10:102635421-102635443 CACAGTGTTATTGTAGAGGCTGG - Intergenic
1074263415 10:111876615-111876637 CACACTCATCTTGTGGAAAAGGG - Intergenic
1075317114 10:121461623-121461645 CACAGGGAGCTTGGGTAGGAAGG - Intergenic
1075948603 10:126458543-126458565 CACACTGATCCTGTGAGGGAGGG - Intronic
1077971422 11:7195590-7195612 CACTGTGAACTACTGGAGGAGGG + Intergenic
1080711574 11:34752815-34752837 CACAGAGAGCCTGTGGAGGTGGG + Intergenic
1087078596 11:94148982-94149004 CACAGTGATCTTGTGGCTAGTGG - Intronic
1087507149 11:99039361-99039383 CACAGTACTCTTGTGGAGAAGGG - Intronic
1089167556 11:116488723-116488745 CACAGGGCTCTTGGAGAGGAAGG + Intergenic
1091121415 11:133060906-133060928 AAAAGTGATCTTGTTGAGGGGGG - Intronic
1092387663 12:8048306-8048328 CACAGTGATCTAGAGGAGGGTGG + Intronic
1096628446 12:52909873-52909895 CACAGCCTTGTTGTGGAGGAAGG + Intronic
1098134375 12:67386263-67386285 TACAGTAATCTTGTTGAGGGTGG + Intergenic
1101865639 12:108517717-108517739 CACAGAGAACTGGTGGAGGTGGG - Intronic
1103870212 12:124085847-124085869 CACAGAGAGCTTGTGGATGGTGG + Intronic
1104643525 12:130481954-130481976 CACAGTGAACTGGTGGTGGGCGG - Intronic
1104686430 12:130787946-130787968 CACAGTGAACTTGCGAAGGATGG + Intergenic
1104896716 12:132168432-132168454 CACAGTGAGCTTGTGGGGAGGGG + Intergenic
1104971688 12:132533693-132533715 CACAGTGATCATGTGCCTGAGGG + Intronic
1105241181 13:18610544-18610566 CACAGGCAGCTTGAGGAGGATGG + Intergenic
1105710753 13:23006801-23006823 CACACTGATGATGAGGAGGAAGG + Intergenic
1106593074 13:31114535-31114557 CACTGTGTGCCTGTGGAGGAGGG + Intergenic
1108801141 13:54096179-54096201 CAAAATGTTCTGGTGGAGGAAGG - Intergenic
1108865671 13:54919676-54919698 CACACTGATGATGAGGAGGAAGG - Intergenic
1110545650 13:76752389-76752411 CACAGTGGTCTTGGGGAGGGAGG - Intergenic
1113769641 13:112899784-112899806 CACACTGACATGGTGGAGGAAGG - Intronic
1115127271 14:30010992-30011014 CCCAGTTATTTTGTGGAGGTGGG - Intronic
1116104610 14:40486134-40486156 CCCAGTGATTTTGCAGAGGATGG + Intergenic
1116107808 14:40533068-40533090 CACTGGGATCTTTTGGAGGGCGG + Intergenic
1116269135 14:42738346-42738368 CACAATGCTCTCATGGAGGAAGG + Intergenic
1116610264 14:47060577-47060599 TACAGGGATTTGGTGGAGGAGGG - Intronic
1116680079 14:47957143-47957165 CACCGTGGTCTAGTTGAGGATGG - Intergenic
1117600238 14:57366666-57366688 CACACTGATGATGAGGAGGAAGG + Intergenic
1120460847 14:84793059-84793081 CACAGATATATTGTGTAGGAAGG - Intergenic
1120651345 14:87136917-87136939 TACATTGATCTTGTTGAGAATGG + Intergenic
1120746020 14:88152701-88152723 CTCAGTGTTCTTGGGCAGGAGGG + Intergenic
1121668484 14:95690750-95690772 CACAGTGCACTTGTGGCAGATGG + Exonic
1121730803 14:96185717-96185739 CAGAGTGACCTTGGGGAGGCGGG + Intergenic
1121907688 14:97762153-97762175 CACAGAGAACTTGTGATGGAGGG + Intronic
1202843826 14_GL000009v2_random:148705-148727 CACACTGATGATGAGGAGGAAGG - Intergenic
1202913228 14_GL000194v1_random:138949-138971 CACACTGATGATGAGGAGGAAGG - Intergenic
1202879424 14_KI270722v1_random:43736-43758 CACACTGATGATGAGGAGGAAGG + Intergenic
1123490174 15:20774603-20774625 CACAGGCAGCTTGAGGAGGATGG - Intergenic
1123546675 15:21343690-21343712 CACAGGCAGCTTGAGGAGGATGG - Intergenic
1123709281 15:22974989-22975011 CACTGTGAGCTTTTTGAGGATGG + Intronic
1123991786 15:25688989-25689011 CAGACTGATTCTGTGGAGGACGG - Intronic
1124067030 15:26354184-26354206 CAAAATGTTCTTCTGGAGGAAGG + Intergenic
1124365508 15:29068531-29068553 CACAGCCCTCTTGTGGGGGAAGG + Intronic
1124397028 15:29311010-29311032 CACAGTAATTTTGTAGAAGAAGG + Intronic
1125174340 15:36803708-36803730 GAGAGTGCTCTTATGGAGGAAGG - Intronic
1125968153 15:43890835-43890857 CACCTTGATTTTGTGAAGGAGGG - Intronic
1126883150 15:53120858-53120880 CACAGTGATCTTAGCGAGAACGG - Intergenic
1127604830 15:60576039-60576061 CACAGTGGTGATGTGGGGGAAGG - Intronic
1127662980 15:61117955-61117977 CAGAGTTATCAAGTGGAGGAGGG - Intronic
1128040140 15:64564771-64564793 CACTGTAATCTAGTGGATGAAGG - Intronic
1128572478 15:68744765-68744787 CACAGTGAACTTTAGGAGAAAGG + Intergenic
1130316913 15:82803799-82803821 GGCAGTGATCTTGGGGAGCAGGG - Intronic
1131771543 15:95743091-95743113 CATAGGGACCTTGTGGAAGATGG - Intergenic
1202955006 15_KI270727v1_random:70905-70927 CACAGGCAGCTTGAGGAGGATGG - Intergenic
1134791336 16:16991860-16991882 TACAGCGATCTTATGAAGGAGGG + Intergenic
1136892218 16:33978115-33978137 CACAGTGAACTTGGGGAAGCAGG + Intergenic
1136982939 16:35074781-35074803 CACACTGATGATGAGGAGGAAGG - Intergenic
1137607000 16:49793572-49793594 CACAGTACTCCTGTGGATGATGG + Intronic
1137775479 16:51050769-51050791 GACAGTGATGCTGTGGATGAGGG - Intergenic
1139948280 16:70656615-70656637 CACACTGATCTTGTAGTTGATGG - Exonic
1140132256 16:72173798-72173820 GACAGATATTTTGTGGAGGAAGG + Intronic
1140937729 16:79690546-79690568 CAGAGTGATGTTCTCGAGGAAGG - Intergenic
1141000728 16:80305026-80305048 CACAGTGGTCATGAGGTGGAAGG - Intergenic
1141165880 16:81660910-81660932 CACAGAGATCTGGTGGTGGGTGG - Exonic
1141242767 16:82278434-82278456 CACATTCATGTTGTGGAGGCTGG + Intergenic
1203080824 16_KI270728v1_random:1145508-1145530 CACAGTGAACTTGGGGAAGCAGG - Intergenic
1143430654 17:6880810-6880832 CACACTGATCATGAGGAGGAAGG - Intronic
1146101887 17:29991039-29991061 CACACTGATAATGAGGAGGAAGG - Intronic
1148792855 17:50183417-50183439 CACCGTGCTCTTGGGAAGGAAGG - Exonic
1151408302 17:73903551-73903573 CCCAGTAATCTTGTTTAGGAAGG + Intergenic
1152177287 17:78796130-78796152 TACAGTTATCTAGTGGAGAAGGG + Exonic
1154198666 18:12284442-12284464 CACGGGGATCTTGGGGAGAAGGG - Intergenic
1154447777 18:14449357-14449379 CACAGGCAGCTTGAGGAGGATGG - Intergenic
1159995269 18:74958407-74958429 CACAGTGGGCCTGTCGAGGAGGG + Intronic
1161152430 19:2716779-2716801 CACTGTGACCTTCTGGGGGAGGG - Exonic
1162252166 19:9454818-9454840 CACACTGATGATGAGGAGGAAGG + Intergenic
1163250309 19:16122851-16122873 CACAGTTCTCTGGTGGAGGGTGG + Intronic
1164032258 19:21418314-21418336 CACACTGATAATGAGGAGGAAGG - Intronic
1164262048 19:23576591-23576613 CACACTGATGATGAGGAGGAAGG - Intronic
1165909528 19:39216566-39216588 CCCAGTCAACATGTGGAGGAAGG + Intergenic
1165948132 19:39457753-39457775 CCCAGTAGTCTTGTGGAGGCAGG - Intronic
1202655042 1_KI270708v1_random:12745-12767 CACACTGATAATGAGGAGGAAGG + Intergenic
926800581 2:16656582-16656604 CACTGTGTCCTTCTGGAGGAGGG - Intronic
926817672 2:16815955-16815977 CACAGTGAGTTTGTGGAGAAGGG - Intergenic
927117929 2:19923455-19923477 CACACTGATGATGAGGAGGAAGG + Intronic
927319655 2:21728247-21728269 CACACTGATCTTGTTGTAGAAGG + Intergenic
927398761 2:22686520-22686542 CACAGTGATTGGTTGGAGGAAGG - Intergenic
928123539 2:28600998-28601020 GACAGAGGTCCTGTGGAGGAGGG + Intronic
928256245 2:29725408-29725430 GACAGGGACCTTGAGGAGGAGGG - Intronic
928703077 2:33918795-33918817 CACACTGATAATGAGGAGGAAGG - Intergenic
929163864 2:38860968-38860990 GGCATTGATCTTGTGGAGGGAGG - Intronic
930183186 2:48385236-48385258 CACACTGATGATGAGGAGGAAGG + Intergenic
930711735 2:54556792-54556814 CTCAGTGACCCTGTGGAGGTGGG + Intronic
933114928 2:78456575-78456597 CACTGGGACCTTTTGGAGGATGG - Intergenic
934727246 2:96631328-96631350 CCCAGTCCTCTGGTGGAGGAGGG + Exonic
934779912 2:96963368-96963390 CAAAGTGCTCTTGCCGAGGAAGG + Intronic
935026027 2:99277874-99277896 CACACTGATGATGAGGAGGAAGG - Intronic
939543995 2:143529817-143529839 CACTGGAATATTGTGGAGGAAGG - Intronic
940707692 2:157125423-157125445 CAAAGTGTTCAGGTGGAGGAAGG - Intergenic
941113744 2:161447795-161447817 CAAAGTGACCTGGTGGAGGATGG + Intronic
941801220 2:169661887-169661909 AAAAGTGATCTAGTGGAGGCAGG + Intronic
942314634 2:174686272-174686294 TACAGTGATCTTGGGGAAAAGGG + Intergenic
942384983 2:175432971-175432993 CACAGTGGTTTTGGTGAGGAAGG + Intergenic
942983065 2:182105786-182105808 CACAATGGTATTGGGGAGGATGG + Intronic
943062477 2:183053035-183053057 CACACTGATGATGAGGAGGAAGG - Intergenic
943329394 2:186540908-186540930 CACAGTGTTCTTTTGGATGAAGG - Intergenic
943483072 2:188446252-188446274 AAGAGTAATCATGTGGAGGATGG + Intronic
944609779 2:201390706-201390728 GACAGTGATTCTGTGGAGGGTGG + Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945414261 2:209551842-209551864 CATAATGATCTTGTGAAGTAGGG + Intronic
946206545 2:218112962-218112984 CACACTGATGATGAGGAGGAAGG + Intergenic
948647997 2:239420849-239420871 CCCTGTGGTCTTGTGGATGAAGG + Intergenic
948978364 2:241478628-241478650 AACAAAGACCTTGTGGAGGAAGG + Intronic
1169403534 20:5303941-5303963 CACACTGATGATGAGGAGGAAGG + Intronic
1170577279 20:17673912-17673934 CACAGTGATTGAGGGGAGGAAGG - Intronic
1173141078 20:40483567-40483589 GAAAGTGATTTTGGGGAGGAAGG - Intergenic
1173834029 20:46113454-46113476 TACAGCAATCTTGGGGAGGAAGG + Intergenic
1174561457 20:51433423-51433445 CCCAGTGATCTCGTGGGGGTAGG - Intronic
1175337058 20:58203523-58203545 CAGAGTGGTCTGGTGAAGGATGG + Intergenic
1175453974 20:59095744-59095766 CAAAGTGCTCTTATGGGGGAAGG - Intergenic
1175535955 20:59712557-59712579 CACTGTGAACTTCTTGAGGACGG + Intronic
1175962945 20:62646232-62646254 CACAGGGCTCTCCTGGAGGAGGG + Intronic
1176632578 21:9153619-9153641 CACACTGATGATGAGGAGGAAGG - Intergenic
1176640728 21:9301200-9301222 CACACTGATAATGAGGAGGAAGG + Intergenic
1177656931 21:24029277-24029299 CACAGTGCTTTTATGGAAGAGGG - Intergenic
1178171986 21:30051291-30051313 CACAGGGATCATGTGGTGGCTGG + Intergenic
1180171376 21:46060481-46060503 CACAGGGCTCTGATGGAGGAGGG + Intergenic
1180349752 22:11790583-11790605 CACACTGATAATGAGGAGGAAGG + Intergenic
1180388452 22:12201656-12201678 CACACTGATAATGAGGAGGAAGG - Intergenic
1180724583 22:17936934-17936956 CACTGTGCTCTTGCAGAGGAAGG - Intronic
1181111762 22:20606617-20606639 CACAGAGACCTTGGAGAGGAGGG - Intergenic
1182718004 22:32375610-32375632 CCCAGGGATCTGGAGGAGGAAGG - Intronic
1183625232 22:38997643-38997665 CACTGTGATCTCCTGGAGGGAGG + Intergenic
1184608572 22:45588228-45588250 CACAGAGATCTGGAGGAAGAGGG + Intronic
1185272958 22:49937046-49937068 CACACTGACCCTGAGGAGGATGG - Intergenic
949217123 3:1583483-1583505 CAGACTGATGTTGTGGAGGGAGG - Intergenic
950511948 3:13435032-13435054 CAGAGTGATCACGTGTAGGAAGG - Intergenic
950691468 3:14661678-14661700 CACTGGGGTCTTGGGGAGGAGGG - Exonic
951270677 3:20619758-20619780 CACACTGATGATGAGGAGGAAGG - Intergenic
951325186 3:21293707-21293729 CACAGTAGTCTTGAGGGGGAAGG - Intergenic
954847665 3:53574051-53574073 CACTGTGCTCTGGAGGAGGAAGG + Intronic
956315477 3:67930794-67930816 AACAGTGATTTTGGGGAAGAAGG - Intergenic
957099432 3:75809415-75809437 CACACTGATGATGAGGAGGAAGG - Intergenic
957496198 3:80994145-80994167 CACAGTGATCTTGGGTAGGCTGG + Intergenic
957597633 3:82288057-82288079 CATACTGATCTTGTGAAGGGAGG - Intergenic
958102620 3:89034336-89034358 CACACTGAGCTGGGGGAGGAGGG - Intergenic
958594165 3:96200879-96200901 CACAAAGATCTTGTGGAGTCTGG + Intergenic
958669438 3:97184366-97184388 CACACTGATTTTGTAGAGGATGG - Intronic
961295751 3:125882930-125882952 CCCAGTGATCTTGGGGATAAAGG - Intergenic
961600997 3:128062034-128062056 CACAGTGCTCTCCTGTAGGATGG - Intronic
962261919 3:133915880-133915902 CACAGAGACCTTCAGGAGGAAGG - Intergenic
963732381 3:148986491-148986513 CTCAGAGATCTGCTGGAGGAGGG + Intergenic
963925914 3:150951127-150951149 CACTGGGATCTTCTTGAGGATGG + Intronic
964397008 3:156256443-156256465 CACAGTGACCCTGGGGAGGGAGG - Intronic
965315307 3:167183204-167183226 CACACTGATGATGAGGAGGAAGG - Intergenic
965609261 3:170527288-170527310 CACAGTCATCCTGATGAGGATGG + Intronic
966978299 3:185105909-185105931 CACACTGATGATGAGGAGGAAGG + Intronic
967714637 3:192748518-192748540 CACAGTGAGCTTTTGGAGGAAGG + Intronic
1202746165 3_GL000221v1_random:103824-103846 CACACTGATAATGAGGAGGAAGG - Intergenic
968807725 4:2786579-2786601 CTCAGTGAGCCTGTGGAGGGTGG - Intergenic
968808084 4:2788005-2788027 CTCAGTGAGCCTGTGGAGGGTGG - Intergenic
970301277 4:14683867-14683889 CACAGTGATCTGTTCAAGGATGG + Intergenic
972080204 4:35140449-35140471 CACACTGATAATGAGGAGGAAGG + Intergenic
973095844 4:46198272-46198294 CACTCTGACCTTGTGGTGGATGG - Intergenic
975014240 4:69392901-69392923 CACATTTATATTGTTGAGGAAGG - Intronic
975879542 4:78887235-78887257 CAAAAGGATCTTCTGGAGGATGG - Exonic
976557020 4:86461610-86461632 CACACTGATGATGAGGAGGAAGG + Intronic
977641989 4:99367758-99367780 CACACTGATGATGAGGAGGAAGG + Intergenic
979893581 4:126131445-126131467 CACACTGATGATGAGGAGGAAGG + Intergenic
980667687 4:135960314-135960336 CACACTGATGATGAGGAGGAAGG - Intergenic
983020984 4:162675345-162675367 CAGACTGATCTTGTGGAAGGAGG - Intergenic
984123958 4:175781960-175781982 CACAGTGATCATGAGCAGAAAGG + Intronic
985100226 4:186451327-186451349 CACAATGAATTTCTGGAGGATGG + Intronic
985338234 4:188919094-188919116 CATAGTGATCTAGTGGAGTTTGG - Intergenic
986093622 5:4535249-4535271 CCCAGTTACCTTGTGGGGGAGGG - Intergenic
987195963 5:15526279-15526301 CACAGTGATCTTGGGCATGGAGG + Intronic
987574046 5:19703388-19703410 CACAATGATGATGAGGAGGAAGG + Intronic
988501103 5:31784448-31784470 CACAGTGATCTTGTGGAGGATGG + Intronic
989413709 5:41149460-41149482 CACAGAGATCTTCTGAATGATGG + Exonic
989742479 5:44789286-44789308 CACACTGATGATGAGGAGGAAGG + Intergenic
990042826 5:51393277-51393299 AACAGAGATCTTTTGGAAGATGG + Intronic
990109405 5:52305199-52305221 CACACTGATGATGAGGAGGAAGG + Intergenic
990325049 5:54666934-54666956 CACAGTCATCTTCTGGAGGTAGG + Intergenic
990380744 5:55220487-55220509 CACAGTGAGCTGGAGGAGGGCGG - Exonic
990801349 5:59607587-59607609 CACAGTGAGCTTGGAGGGGAGGG + Intronic
991357340 5:65782557-65782579 CATAGTGAGCTTGTGGAGGAAGG + Intronic
993046670 5:82874050-82874072 CACAGTGATATTGAAGAAGAGGG - Intergenic
995030488 5:107474998-107475020 CACAGTCATATTGTGGAAGCAGG - Intronic
995445192 5:112235154-112235176 CCGAGTGGTCTTGTGGGGGATGG - Intronic
995592339 5:113712629-113712651 CACACTGATGATGAGGAGGAAGG + Intergenic
995950239 5:117703559-117703581 CACACTGATATTGTGCAGAATGG - Intergenic
996703283 5:126471239-126471261 CAGATTGATCCTGTGGAGGGAGG + Intronic
997403364 5:133620716-133620738 CACAGTGGTTAGGTGGAGGAAGG - Intergenic
997872869 5:137520543-137520565 CTCAGTGACCTTGTGCCGGAGGG - Intronic
999194234 5:149771262-149771284 CACAGTCATCCTGAGGATGATGG + Intronic
999268797 5:150284467-150284489 CACTGTGTGCTTGTGGAGGGAGG + Intronic
1000555330 5:162718546-162718568 CACAGAGACCTTGAGGAGGGAGG - Intergenic
1001335750 5:170795350-170795372 CACAGTGACTTCATGGAGGAAGG - Exonic
1001954895 5:175842517-175842539 CCCAGTGAACTCGAGGAGGAAGG - Intronic
1002522459 5:179799301-179799323 CACAGTGCTTCTGTGGAGGGTGG + Exonic
1003522543 6:6870624-6870646 CACAGTGATGTGGTGGTAGATGG + Intergenic
1006038698 6:31235365-31235387 CACACTGATGATGAGGAGGAAGG - Intergenic
1007731902 6:43952494-43952516 CACAGTGGTCTTGTGGGGAGAGG - Intergenic
1007886537 6:45236430-45236452 CACACTGATGATGAGGAGGAAGG + Intronic
1009062939 6:58418981-58419003 CACACTGATGATGAGGAGGAAGG - Intergenic
1009250619 6:61293528-61293550 CACACTGATGATGAGGAGGAAGG - Intergenic
1012254702 6:97017908-97017930 CCAAGTGATCATGTGGATGATGG + Intronic
1013507311 6:110814206-110814228 CACAGTCATCTGGCAGAGGATGG + Intronic
1013739666 6:113267766-113267788 CACACTGATCATGTGGAGGAAGG - Intergenic
1015005690 6:128278632-128278654 CCCAGTGGCCTTGTGCAGGATGG - Intronic
1015521052 6:134131511-134131533 CAGATTGCTCTTGCGGAGGATGG - Intergenic
1016156611 6:140817912-140817934 CAGAGGGGTCATGTGGAGGAGGG + Intergenic
1016431207 6:143988156-143988178 CACAGTCATCTGGTGGTGTACGG + Intronic
1017588639 6:155954103-155954125 CTCAGTGATCTTGGGCAAGATGG - Intergenic
1017636097 6:156444523-156444545 CCAAGGGTTCTTGTGGAGGAGGG - Intergenic
1017725253 6:157272582-157272604 CACAGCGAGCAGGTGGAGGAGGG - Intergenic
1022016117 7:26349950-26349972 CCCAGTGCCCTTATGGAGGAGGG - Intronic
1024675201 7:51631913-51631935 CCCAGTGATGTCCTGGAGGAGGG - Intergenic
1024760644 7:52593079-52593101 CACTGTGAAATTGTGGAAGAAGG - Intergenic
1025102294 7:56145567-56145589 CACACTGATAATGAGGAGGAAGG + Intergenic
1025122572 7:56317641-56317663 CACACTGATGATGAGGAGGAAGG + Intergenic
1026334797 7:69384393-69384415 CACAGTGATTTTGTGGGGGAAGG - Intergenic
1028358760 7:89941608-89941630 CACAGTGGTGTTGTGTAGGTAGG - Intergenic
1028547606 7:92021051-92021073 GACAATGATCTTCTTGAGGAGGG - Intronic
1028954717 7:96675688-96675710 AACAGGGAGCTGGTGGAGGAAGG - Intronic
1029410816 7:100409212-100409234 TAAAGTGATCTTGTTGGGGAGGG - Intronic
1029600535 7:101560763-101560785 CACAGCAATCATGTGGAGGAAGG + Intergenic
1032539447 7:132691115-132691137 CACATTGATCTGGTGGTGGTTGG + Intronic
1033047234 7:137973577-137973599 AACTGTGATCTTGTGTCGGATGG - Intronic
1034866643 7:154647943-154647965 CTCAGTGATTGTGTGGAAGAAGG - Intronic
1035619892 8:1028896-1028918 CACTGTGAGCCTGTGAAGGACGG + Intergenic
1036412254 8:8513009-8513031 CAAAATGATTTTGTGGGGGATGG + Intergenic
1037938042 8:22928280-22928302 CACAGTGACCTTGTGTAGGAGGG + Intronic
1038892075 8:31736875-31736897 CACAGTGATATTGTGGGAGAGGG - Intronic
1039362153 8:36888387-36888409 CAGAGTGGTGTTGTGGGGGAGGG - Intronic
1039955117 8:42201405-42201427 CTCAGTGCTTTTGTTGAGGAAGG - Intronic
1040381471 8:46877241-46877263 CACACTGATGATGAGGAGGAAGG + Intergenic
1040528943 8:48249787-48249809 CACACTGATGATGAGGAGGAAGG - Intergenic
1041018838 8:53617775-53617797 CACACTGATGATGAGGAGGAAGG + Intergenic
1042446319 8:68889350-68889372 CACACTGATGATGAGGAGGAAGG + Intergenic
1043069438 8:75620388-75620410 TACAGTCAGGTTGTGGAGGAGGG - Intergenic
1043403616 8:79908429-79908451 CACAGAGATTCTGTGGTGGAAGG + Intergenic
1046149668 8:110207119-110207141 CACTGGGGTCTTTTGGAGGATGG - Intergenic
1049857461 8:144871753-144871775 CACACTGATGATGAGGAGGAAGG + Intergenic
1050816269 9:9816707-9816729 CACAGTGATATTTTGGGGTAAGG - Intronic
1053126197 9:35582666-35582688 CACACTGATGATGAGGAGGAAGG + Intergenic
1056485697 9:87055004-87055026 CACAGTGACCTTAGGGAGAAGGG + Intergenic
1057286027 9:93755084-93755106 CACACTGATGATGAGGAGGAAGG - Intergenic
1057719262 9:97518954-97518976 CACAGTGAACATCTTGAGGATGG - Intronic
1058172819 9:101703341-101703363 CATAGTGATCTAGAGGAAGAAGG - Intronic
1058710095 9:107671698-107671720 CAAAATGATGTTGTGGAAGAAGG - Intergenic
1058944884 9:109846939-109846961 CACAGAGAGCTTGTGGAAAATGG - Intronic
1059070714 9:111132915-111132937 CTCAGTGATCTTTTTGAGGAAGG + Intergenic
1060666448 9:125434959-125434981 AACAGTGATGTTGGGGAGCATGG + Intergenic
1061391182 9:130318039-130318061 AACAGTGACCTTGTGTAGGGCGG + Intronic
1061448998 9:130658815-130658837 CTCAGGGAAGTTGTGGAGGAAGG + Intergenic
1203687223 Un_GL000214v1:6515-6537 CACACTGATGATGAGGAGGAAGG + Intergenic
1203755410 Un_GL000218v1:121243-121265 CACACTGATGATGAGGAGGAAGG - Intergenic
1203714785 Un_KI270742v1:133783-133805 CACACTGATGATGAGGAGGAAGG - Intergenic
1203649052 Un_KI270751v1:97538-97560 CACACTGATGATGAGGAGGAAGG - Intergenic
1186819529 X:13272629-13272651 GTCAGTTATCTTGTGAAGGATGG - Intergenic
1186948647 X:14597436-14597458 CACAGAGATGTTGAGCAGGATGG + Intronic
1190912499 X:54786138-54786160 CAGAGTGACCATGTGGATGATGG - Intronic
1190918460 X:54827270-54827292 CAGAGTGACCATGTGGATGATGG + Intergenic
1192201902 X:69071491-69071513 CACAGTGGTCTGGTGGGGGATGG + Intergenic
1193048651 X:77078610-77078632 CACACTGATTATGAGGAGGAAGG + Intergenic
1194389125 X:93294322-93294344 AACAGTGTTAGTGTGGAGGAGGG + Intergenic
1194536260 X:95108536-95108558 CACACTGATGATGAGGAGGAAGG - Intergenic
1195377425 X:104241278-104241300 TACAGTGACCTTGGGGAGGTGGG + Intergenic
1195983234 X:110601834-110601856 CACTGTGATCATTTGGAGAAGGG - Intergenic
1198140515 X:133798177-133798199 CACTCTGATCTTTTGGGGGAAGG - Intronic
1199637975 X:149831603-149831625 CACTGTGACCTTGAGGATGAGGG - Intergenic
1199734062 X:150667705-150667727 CACAGTGATCATAGGGAGAATGG + Intronic
1200048269 X:153414028-153414050 CTCAGTAATCTTGGGGTGGAGGG + Intergenic
1200896670 Y:8383153-8383175 CACAATAATCTTGTTGGGGATGG + Intergenic
1202074530 Y:21025132-21025154 CACAGTGTTCTCGCAGAGGATGG - Intergenic
1202164108 Y:21968742-21968764 CACACTGATGATGGGGAGGAAGG - Intergenic
1202227248 Y:22617622-22617644 CACACTGATGATGGGGAGGAAGG + Intergenic
1202315874 Y:23578032-23578054 CACACTGATGATGGGGAGGAAGG - Intergenic
1202554891 Y:26092042-26092064 CACACTGATGATGGGGAGGAAGG + Intergenic