ID: 988504658

View in Genome Browser
Species Human (GRCh38)
Location 5:31811378-31811400
Sequence TTACACCATCACTGCAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1476
Summary {0: 1, 1: 0, 2: 11, 3: 520, 4: 944}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988504658_988504660 -2 Left 988504658 5:31811378-31811400 CCAGGGCTGCAGTGATGGTGTAA 0: 1
1: 0
2: 11
3: 520
4: 944
Right 988504660 5:31811399-31811421 AATAGCTGACTCATCCCTCAGGG 0: 1
1: 0
2: 0
3: 9
4: 111
988504658_988504663 16 Left 988504658 5:31811378-31811400 CCAGGGCTGCAGTGATGGTGTAA 0: 1
1: 0
2: 11
3: 520
4: 944
Right 988504663 5:31811417-31811439 CAGGGCTCTTTGTTCACCAAAGG 0: 1
1: 0
2: 1
3: 13
4: 126
988504658_988504659 -3 Left 988504658 5:31811378-31811400 CCAGGGCTGCAGTGATGGTGTAA 0: 1
1: 0
2: 11
3: 520
4: 944
Right 988504659 5:31811398-31811420 TAATAGCTGACTCATCCCTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988504658 Original CRISPR TTACACCATCACTGCAGCCC TGG (reversed) Intronic
900542195 1:3208733-3208755 TTACAGCAACTCTGCTGCCCAGG - Intronic
900699664 1:4037791-4037813 TTAAACCATCCCTGCATCCCTGG - Intergenic
901266302 1:7913471-7913493 TTACACCCTCCCTGCAGTCAGGG + Intergenic
901354338 1:8630625-8630647 TGACAGCATCACTGGAGCCCTGG + Intronic
902354951 1:15891229-15891251 TTGCACCACCACTCCAGCCAGGG - Intronic
902967994 1:20024969-20024991 TTAAACCATCCCTGCATCACTGG + Intergenic
903249207 1:22040228-22040250 TTACCCTAGCACAGCAGCCCAGG + Intergenic
903633680 1:24797738-24797760 TTTCACCATCACTGCCAGCCTGG - Exonic
904370496 1:30044859-30044881 ACACACCATCATTGGAGCCCTGG - Intergenic
904569624 1:31453124-31453146 TTAAACCATCCCTGCATCCCTGG + Intergenic
904849848 1:33449527-33449549 TTAAATCATCCCTGCATCCCTGG - Intergenic
905233500 1:36530091-36530113 CTCCTCCATCACTGCATCCCTGG - Intergenic
906070031 1:43009632-43009654 TTCGAGCATCACAGCAGCCCTGG + Intergenic
906131181 1:43458115-43458137 TTAAACCATCCCTGCATCCCTGG - Intergenic
906563689 1:46780257-46780279 TTAAACAATCCCTGCATCCCTGG + Intronic
906644931 1:47467875-47467897 TTAACCCATCACTGCATCTCTGG + Intergenic
906869256 1:49458879-49458901 TTAAACCATCCCTGCATCCCTGG + Intronic
906910817 1:49947366-49947388 TTAAACCATCCCTGCATCCCTGG - Intronic
906914940 1:49998755-49998777 TTAAACCATCCCTGCATCCCTGG - Intronic
906956007 1:50374609-50374631 TTAAACCATCCCTGCATCCCTGG - Intergenic
907349517 1:53815274-53815296 TTAAACCATCCCTGCATCCCTGG - Intronic
907887058 1:58602295-58602317 TTAAACTATCCCTGCATCCCTGG + Intergenic
908298886 1:62741583-62741605 TTAAACCATCCCTGCATCCCTGG - Intergenic
908604527 1:65781247-65781269 TTAAACCATCTCTGCATCCCTGG - Intergenic
908660378 1:66428554-66428576 TTAAACCATCCCTGTATCCCTGG + Intergenic
908667929 1:66512715-66512737 TTAAACCATTCCTGCATCCCTGG - Intergenic
908890483 1:68841808-68841830 TTAAACCATCCCTGTATCCCTGG + Intergenic
908982107 1:69970951-69970973 TTAAACCATCCCTGCATCCCTGG - Intronic
909098626 1:71322062-71322084 TTAAACCATTCCTGCATCCCTGG - Intergenic
909248638 1:73323724-73323746 TTAAACCATCTTTGCATCCCTGG + Intergenic
909298868 1:73985342-73985364 GTAAACCATCCCTGCATCCCTGG + Intergenic
909404597 1:75273696-75273718 TTAAACCATCCCTACATCCCTGG + Intronic
909511046 1:76452597-76452619 TTAAACTATCCCTGCATCCCTGG + Intronic
909546064 1:76848328-76848350 TTGAACCATCCCTGCATCCCAGG + Intergenic
909593640 1:77380178-77380200 GTACACCATCATGCCAGCCCTGG + Intronic
909673955 1:78218373-78218395 TTAAACCATCCCTGCATCCCTGG - Intergenic
909748888 1:79134517-79134539 TTACACCAGTACTCCAGTCCTGG - Intergenic
909860425 1:80597847-80597869 TTAAACCATCCCTGTATCCCTGG - Intergenic
909948042 1:81685955-81685977 TTAAACCATCTGTGCATCCCTGG + Intronic
910233442 1:85009631-85009653 TTAAACCATCCCTGCATCCCTGG - Intronic
910380755 1:86623858-86623880 TTAAACCATCCCTGCATCCCTGG - Intergenic
910738660 1:90491341-90491363 TTAAACCATCCCTGCATCCTTGG + Intergenic
910797339 1:91111600-91111622 TTATACCATCCTTGCATCCCTGG - Intergenic
911014184 1:93314669-93314691 TTGAACCATCATTGCATCCCTGG - Intergenic
911081024 1:93931039-93931061 TTAAACCATCCCTGCATCCCTGG - Intergenic
911265587 1:95739426-95739448 TTAAATCATCCCTGCACCCCTGG + Intergenic
911678650 1:100689255-100689277 TTAAAACATCCCTGCATCCCTGG + Intergenic
911743570 1:101414371-101414393 TTAAACCATCCCTGCATCCCTGG - Intergenic
911795195 1:102066542-102066564 TTAAACCATCCCTGCATCCCTGG - Intergenic
911805888 1:102207645-102207667 TTAAACCATCCCTGAATCCCTGG + Intergenic
911999314 1:104810792-104810814 TTAAACCATCCCTGCATCCCTGG + Intergenic
912081401 1:105941825-105941847 TTAAACCATCCCTGCATCCATGG + Intergenic
912121538 1:106478130-106478152 TTAAACCATCCCTGCATCCTTGG - Intergenic
912457000 1:109804708-109804730 TGACACCTTCACTGCAGCCCTGG - Intergenic
913151676 1:116050416-116050438 TTAAACCATCCCTGCTTCCCTGG - Intronic
913339424 1:117743687-117743709 TTCAACCATCCCTGCATCCCTGG + Intergenic
913383705 1:118236957-118236979 TTAAACCATCCCTGCATCCCTGG - Intergenic
913402578 1:118452811-118452833 TTAAACCATCCCTGCCTCCCTGG - Intergenic
913464036 1:119120713-119120735 TTAAACCAACCCTGCATCCCTGG - Intronic
913493822 1:119408541-119408563 TTAAACCATCCCTGCATCCCTGG - Intergenic
914346399 1:146802840-146802862 TTAAACCATCCCTGAATCCCTGG - Intergenic
914455072 1:147828821-147828843 TTAAACCATCCCTGCATCCCTGG + Intergenic
915821359 1:159027347-159027369 TTAAACCATCCCTGCGTCCCTGG + Intronic
916022406 1:160804408-160804430 TTAAACCATCCTTGCATCCCTGG + Intronic
916247987 1:162707538-162707560 TTGCACCAACCCTGCAGCCATGG + Intronic
916331401 1:163621476-163621498 TTAAACCATCCTTGCATCCCTGG + Intergenic
916580945 1:166107815-166107837 TTAAACCATCCCTGCATCCGTGG - Intronic
916872847 1:168936142-168936164 TTAAACCATCCCTGCATCCCTGG + Intergenic
916902932 1:169249797-169249819 TTAAACCATCCCTGCATCCCTGG + Intronic
917300247 1:173565996-173566018 TTGAACCATCCCTGCATCCCTGG + Intronic
917319319 1:173762554-173762576 TTAAACCATCCCTGCATCCCTGG - Intronic
917372797 1:174313822-174313844 TTGAACCATCCCTGCATCCCAGG + Intronic
917461894 1:175238299-175238321 TTGAACCATCCCTGCATCCCTGG - Intergenic
917693893 1:177498637-177498659 TTAAACCATCCTTGCATCCCTGG - Intergenic
917746614 1:178015040-178015062 TTAAACCATCCCTGCATCCCTGG + Intergenic
917907673 1:179603695-179603717 TTAAACCATCCCTGCCTCCCTGG + Intronic
917913288 1:179674360-179674382 TTAAACCATCCCTGCATCCCTGG + Intronic
918172213 1:182009049-182009071 TTAAACCATCCCTGAATCCCTGG - Intergenic
918721468 1:187857759-187857781 TTAAACCATCCCTGCATCCCTGG + Intergenic
918749603 1:188256626-188256648 TTAAACCATCCCTGCATCCCAGG + Intergenic
918873791 1:190011710-190011732 TTAAACCATCCCTACATCCCTGG - Intergenic
918938757 1:190961597-190961619 TTGAACCATCCATGCAGCCCTGG - Intergenic
919111611 1:193226638-193226660 TTAAACCATCCCTGCATCCTTGG + Intronic
919115186 1:193272797-193272819 TTAAACCATCCCTGAATCCCTGG + Intergenic
919281229 1:195492061-195492083 TTAAACCATGTCTGCATCCCTGG + Intergenic
919407722 1:197205567-197205589 TTAAACCATCCCTGCATCTCTGG + Intergenic
919436940 1:197573773-197573795 TTAAACCAGCCCTGCATCCCAGG - Intronic
919571557 1:199255342-199255364 TTAAACCATTCCTGCATCCCTGG + Intergenic
920726648 1:208442053-208442075 TTAAATCATCCCTGCATCCCTGG + Intergenic
920990132 1:210929349-210929371 TTAAACCATCCCTGCATCCCTGG - Intronic
921001077 1:211043762-211043784 TTAAACCTTCCCTGCATCCCTGG - Intronic
921210391 1:212891400-212891422 TCACACCACCACTCCAGCCTGGG + Intronic
921409630 1:214822014-214822036 TTAAACCATCCCTGCAGCCCTGG + Intergenic
921496713 1:215851860-215851882 TTAAACCATCCCTGCATCCCTGG - Intronic
921610111 1:217202821-217202843 TTAAACCATCTTTGCACCCCGGG + Intergenic
921834831 1:219767543-219767565 TTAAACCATCCCTGCATCTCCGG - Intronic
922377297 1:224981105-224981127 TTAAACCATCCCTGCATCCCTGG + Intronic
922995624 1:229956964-229956986 TTAAACCATCCCTGCATCCCTGG + Intergenic
923149042 1:231217696-231217718 CTCCACCATCACCACAGCCCAGG + Intronic
923459090 1:234192273-234192295 TTAAACCATCCCTGCATCCCTGG - Intronic
923648557 1:235849189-235849211 TTAAACCATCCCTGCATCCCTGG - Intronic
923662004 1:235965907-235965929 TTAAACCATCCCTGCATCCCTGG - Intergenic
923691628 1:236199217-236199239 TTAAACCATCCCTGCATCCCTGG + Intronic
923808339 1:237285347-237285369 TTAAACCATCCCTGCATCCCTGG + Intronic
923875624 1:238043599-238043621 TTAAATCATCCCTGCATCCCTGG - Intergenic
923909826 1:238429037-238429059 TTAAACCATCCCTGCATCCCTGG + Intergenic
924528352 1:244871818-244871840 TTACACCAGCACTCCAGCCCTGG + Intergenic
924885090 1:248206625-248206647 TTAAACCATCCCTACATCCCTGG + Intergenic
924894487 1:248321046-248321068 TTAAACCATTCCTGCATCCCTGG - Intergenic
924935087 1:248761600-248761622 TTAAACCATCCCTGCATCCATGG - Intergenic
1063055015 10:2495419-2495441 TGACACCTTGACTGCAGCCAGGG - Intergenic
1063081104 10:2767973-2767995 TTAAACCATCCCTGCATCCCTGG - Intergenic
1063088335 10:2839455-2839477 TTACACCACCACTGGATCCTGGG - Intergenic
1063328464 10:5130091-5130113 TTATACCATCCCTGCACCCTTGG - Intronic
1063555914 10:7079471-7079493 TTAAACCATCCCTGCATCCCTGG - Intergenic
1064556906 10:16556062-16556084 TTAAACCATCCCTGTATCCCTGG + Intergenic
1064867904 10:19902993-19903015 TTAAACCATCCCTGCATCCCTGG + Intronic
1064907815 10:20366811-20366833 TTAAACCATCCCTCCATCCCTGG + Intergenic
1065079707 10:22115879-22115901 TTAAACTATCCCTGCATCCCTGG - Intergenic
1065418255 10:25512850-25512872 TTAAACCATTTCTGCATCCCTGG + Intronic
1065465142 10:26011921-26011943 TTAAACTATCCCTGCATCCCTGG - Intronic
1066145205 10:32550717-32550739 TTAAACCATCCCTGCATCCCTGG + Intronic
1066651352 10:37658694-37658716 TTAAACCATCTCTGCATCCCTGG - Intergenic
1066784530 10:38988626-38988648 TTAAACCATCCCTGCATCCCTGG - Intergenic
1066983480 10:42441457-42441479 TTAAACAATCCCTGCATCCCTGG + Intergenic
1067371663 10:45689334-45689356 TTAATCCATCCCTGCATCCCTGG - Intergenic
1067388118 10:45836815-45836837 TTAATCCATCCCTGCATCCCTGG + Intronic
1067418005 10:46120465-46120487 TTAATCCATCTCTGCATCCCTGG - Intergenic
1067503362 10:46827028-46827050 TTAATCCATCCCTGCATCCCTGG - Intergenic
1067875144 10:49999284-49999306 TTAATCCATCCCTGCATCCCTGG - Intronic
1067963455 10:50882389-50882411 TTGCACCACCACTCCAGCCTAGG + Intronic
1068011082 10:51452610-51452632 TGAAACCATCACTGCATCCCTGG + Intronic
1068161933 10:53275729-53275751 TTAAACCATTCCTGCATCCCTGG - Intergenic
1068172577 10:53415118-53415140 TCAAACCATCCCTGCATCCCTGG + Intergenic
1069113235 10:64472261-64472283 TTATACCATCCCTGCATCCCTGG - Intergenic
1069218189 10:65849136-65849158 TTAAACCATCCCTGCATCCCTGG - Intergenic
1069274974 10:66578636-66578658 TTAAACCAACATTGCATCCCAGG + Intronic
1069325706 10:67229140-67229162 TTAAACCATCCCTGCATCCCTGG - Intronic
1069419625 10:68235412-68235434 TCACACCATCATTTCAGCACAGG + Intergenic
1069648527 10:70023689-70023711 TTAAACCATCCCTGCATCCCTGG - Intergenic
1070134953 10:73685500-73685522 TTAATCCATCCCTGCATCCCTGG + Intronic
1070433700 10:76367072-76367094 TTAAACCATCCCTGCATCCCTGG + Intronic
1070548239 10:77469686-77469708 AGACACCATCACTGAATCCCTGG - Intronic
1071015526 10:80993024-80993046 TTACACCATTCCTGTATCCCTGG + Intergenic
1071023878 10:81089528-81089550 TTAAACCTTCCCTGCATCCCCGG + Intergenic
1071383438 10:85095401-85095423 TTAAAACATCCCTGCATCCCTGG - Intergenic
1071400141 10:85260906-85260928 TTTCTCCATCACTGCCTCCCTGG + Intergenic
1071812023 10:89192900-89192922 TTAAACCATCCCTGCATCTCTGG + Intergenic
1072246239 10:93546782-93546804 CTCCACCATCACTGCAGCAGGGG + Intergenic
1072380583 10:94865351-94865373 TTAAACCATCCTTGCATCCCTGG + Intergenic
1072392866 10:95006558-95006580 TTAAACCATCCCTGCATCCCTGG + Intergenic
1072768958 10:98120616-98120638 TTAAACCATCCCTGCATCCCTGG + Intergenic
1072872008 10:99130450-99130472 TTAAACCATCTCTGCATCTCTGG - Intronic
1072928335 10:99637112-99637134 TTAAACCATCTCTGCATCCCTGG - Intergenic
1073820526 10:107257915-107257937 TTAAACCATCCCTACATCCCTGG - Intergenic
1074985497 10:118655383-118655405 TTAAACCATCCCTGCATCCCTGG + Intergenic
1075157807 10:119993771-119993793 TTAAACCATCCCTGCATCCCTGG + Intergenic
1075494094 10:122903894-122903916 TTAAACCATCCCTGCATCCTTGG - Intergenic
1075660299 10:124189906-124189928 TTAAACCATCCCTGTATCCCTGG + Intergenic
1075889379 10:125933019-125933041 TTAAACCATCCCTGCATCCCTGG + Intronic
1075982429 10:126752195-126752217 TTAAACCATCCCTGCATCCCTGG + Intergenic
1076376194 10:129987662-129987684 TTAGGCCATCCCTGCATCCCTGG - Intergenic
1077314583 11:1912695-1912717 TGACAGCATCACTTGAGCCCAGG - Intergenic
1077833926 11:5906911-5906933 TTAAACCATCTCTGCACACCTGG + Intronic
1077964043 11:7108320-7108342 TTAAACCATCCCTGCATCCCTGG + Intergenic
1078411665 11:11126096-11126118 TTAAACCATCTCTGCATCCCTGG + Intergenic
1078592867 11:12660504-12660526 TTAAACCATCCCTTCATCCCTGG + Intergenic
1078927775 11:15890042-15890064 TTTAATCCTCACTGCAGCCCAGG + Intergenic
1079270433 11:18980252-18980274 TTAACCCATCCCTGCATCCCTGG + Intergenic
1079273345 11:19009881-19009903 TTGAACCATCCCTGCATCCCTGG + Intergenic
1079463920 11:20710365-20710387 TTAAACCATCCCTCCATCCCTGG + Intronic
1079791353 11:24744034-24744056 TTATACTATCCCTGCATCCCTGG + Intronic
1079805735 11:24928548-24928570 TTAAACCATCCCTGCATCCCTGG + Intronic
1080152717 11:29072849-29072871 TTAAACCATCCCTGCATCCCTGG + Intergenic
1080402611 11:31950674-31950696 TTAAACCATCCCTGCATCCGTGG - Intronic
1080646982 11:34194577-34194599 TTACAGCATTACTGCAGGCTGGG - Intronic
1080670103 11:34368113-34368135 TTAAACCATCCCTGCATCCCTGG - Intergenic
1080672214 11:34391372-34391394 TTAAACCATTCCTGCATCCCTGG + Intergenic
1080799423 11:35596326-35596348 TTAAACCATCCCTGCAACCCTGG + Intergenic
1080863561 11:36172645-36172667 TTAAACCAGCCCTGCATCCCTGG + Intronic
1081090778 11:38863725-38863747 TTAAACCATCCCTGCATTCCTGG + Intergenic
1081326381 11:41750531-41750553 TTAAACCATCCCTGCATCCCTGG + Intergenic
1081808997 11:45904913-45904935 TGTCACCCTCACTGCAGGCCAGG + Intronic
1081917223 11:46740223-46740245 CTACACCTGCACTGCAGCCTGGG + Intergenic
1082104275 11:48203546-48203568 TTAAACCATCCCTGAATCCCTGG - Intergenic
1082206901 11:49447600-49447622 TTAAACTATCCCTGCATCCCTGG - Intergenic
1083005441 11:59340847-59340869 TTAAACCATCCCTGAATCCCTGG + Intergenic
1083016992 11:59464398-59464420 TTAAACCATCCCTGCATCCCTGG - Intergenic
1083046357 11:59739363-59739385 TTAAACCATCCCTGCCTCCCTGG + Intronic
1083064258 11:59907643-59907665 TTAAACCATCCCTGCAACCGTGG + Intergenic
1083497053 11:63064637-63064659 TCAAACCATCCCTGCATCCCTGG + Intergenic
1083813686 11:65119815-65119837 TTTAACCCTCACAGCAGCCCTGG + Intergenic
1085406266 11:76264828-76264850 TGACAGGATCACTGGAGCCCCGG - Intergenic
1085748236 11:79133674-79133696 TTAAACCATCCCTGCATCCCTGG - Intronic
1086123285 11:83323511-83323533 TTAAATCATCCCTGCATCCCTGG + Intergenic
1086648371 11:89254144-89254166 TTAAACTATCCCTGCATCCCTGG + Intronic
1086743208 11:90393078-90393100 TTAAACCATCCTTGCATCCCTGG - Intergenic
1086813540 11:91340238-91340260 TTAAGCCATCCCTGCATCCCTGG - Intergenic
1086819306 11:91415116-91415138 TTAAACCATCCCTGCATTCCTGG - Intergenic
1086825006 11:91485759-91485781 TTACAACATCCCTGCTTCCCTGG + Intergenic
1086844730 11:91734257-91734279 TTAAACCATCCCTGCATCCTTGG - Intergenic
1086877657 11:92116176-92116198 TTAAAGCATCCCTGCATCCCTGG - Intergenic
1087090533 11:94267229-94267251 TTAAACCATCCCTTCATCCCTGG - Intergenic
1087106160 11:94409471-94409493 TTAAACCACCCCTGCATCCCTGG - Intergenic
1087395587 11:97592822-97592844 TTAAACCATCCCTGCATCCTTGG - Intergenic
1087731359 11:101781819-101781841 TTAAACCATCCCTGCATCCCTGG + Intronic
1087905043 11:103685750-103685772 TTAAACCATCCCTGCATGCCTGG - Intergenic
1087942615 11:104117053-104117075 TTAAACCATCCCTGCATCCCTGG - Intronic
1087978189 11:104576254-104576276 TGAGACCATCACTGCTGCCATGG - Intergenic
1088079808 11:105897728-105897750 TTAAACCATCCTTGCATCCCTGG + Intronic
1088206755 11:107400887-107400909 TTAAACCATCCCTACATCCCTGG - Intronic
1088372168 11:109103210-109103232 TTAAACCATCCCTGCAACCTTGG + Intergenic
1088387152 11:109271949-109271971 TTAAACCATCCTTGCATCCCTGG + Intergenic
1088413220 11:109559420-109559442 TTAAATCATCCCTGCATCCCTGG + Intergenic
1088413498 11:109563751-109563773 TTAGACCATCCCTGCATCCCTGG + Intergenic
1088520848 11:110698239-110698261 TTGAACCATCATTGCATCCCTGG + Intronic
1088580902 11:111315342-111315364 TGAAACCATCCCTGCATCCCTGG - Intergenic
1088686003 11:112284989-112285011 TTTCACCACCACTGCCGCTCTGG - Intergenic
1088800378 11:113300809-113300831 TTAAACCATCCCTGCATCCCTGG - Intergenic
1088962937 11:114688405-114688427 TTAAACCATCCTTGCATCCCTGG + Intronic
1089107701 11:116027461-116027483 TTAAACCACCCCTGCATCCCTGG - Intergenic
1089250250 11:117154505-117154527 TTGCACCATTACTGCAGCCTTGG + Intronic
1089905206 11:122031312-122031334 TTACACCAGCACCCCACCCCTGG - Intergenic
1090483509 11:127089310-127089332 TTAAACCATCCCTGCATCACTGG - Intergenic
1090894695 11:130960960-130960982 TTAAACCATCCCTGCATCCCTGG + Intergenic
1091210149 11:133850694-133850716 TTAAACCATCCCCGCATCCCTGG + Intergenic
1091381125 12:60952-60974 TTAAACCATCCCTGTATCCCTGG - Intergenic
1092399385 12:8161145-8161167 TTAAACCATCCCTGCATCTCTGG + Intronic
1092438023 12:8468609-8468631 TTAAACCATCCTTGCATCCCTGG - Intronic
1092603009 12:10087288-10087310 TTAAACCATCCCTGCATCCCTGG - Intronic
1092605107 12:10110107-10110129 TTAAACCATCCCTGCATCCCTGG - Intronic
1092700301 12:11221377-11221399 TTAAACCATCCCTGCATCCCTGG - Intergenic
1093001722 12:14004408-14004430 TTAAACCATCCCTGCACCCCTGG + Intergenic
1093468645 12:19477603-19477625 TTAAACCATCTCTGCATCCATGG + Intronic
1093488389 12:19677969-19677991 TTAAACCATCCCTGCATCCGTGG + Intronic
1093810828 12:23490558-23490580 TGAAACCATCTCTGCATCCCTGG + Intergenic
1093951901 12:25171793-25171815 TTAAACCATCCCTGCATCCCTGG - Intronic
1093964061 12:25306874-25306896 TTAAACCATCCCTGCATCCCTGG - Intergenic
1094263133 12:28524420-28524442 TTAAACTATCCCTGCATCCCTGG + Intronic
1094297495 12:28924535-28924557 TTAAACCATCCCTGCATCCCTGG - Intergenic
1094446988 12:30542108-30542130 TTAAACCATCCCTGCATCCCTGG + Intergenic
1094802368 12:34051193-34051215 TTAAACCATCCCTGCATCCCTGG - Intergenic
1095117934 12:38378462-38378484 TTAAACCATCCCTGCATCTCTGG + Intergenic
1095226107 12:39678770-39678792 TTAAACCATCCCTGCATCCCTGG - Intronic
1095733072 12:45526284-45526306 TTAAACCATCCCTGCATCCCTGG - Intergenic
1095893248 12:47254523-47254545 TTAAACCATCCCTGCATCCCTGG - Intergenic
1095932385 12:47640473-47640495 TTAAACCATCCCTGCATCCCTGG - Intergenic
1096012135 12:48227792-48227814 TTAAACCATCCCTGCATCCCTGG - Intergenic
1096032188 12:48428988-48429010 TTAAACCGTCTCTGCATCCCTGG - Intergenic
1096101327 12:48972001-48972023 CTACACCCTCCCTGCAGCCTTGG - Intergenic
1096512097 12:52136364-52136386 TTCCACCTTCACTCGAGCCCTGG - Intergenic
1096888285 12:54740303-54740325 TTAAATCATCCCTGCATCCCTGG + Intergenic
1096903860 12:54914671-54914693 TTAAACCATCCCTGCATCCCTGG - Intergenic
1096961824 12:55586890-55586912 TTAAACCATCCCTGCATCCCTGG - Intergenic
1097236093 12:57540650-57540672 GTACGCCAACACTGCAGCCAGGG + Intronic
1097295823 12:57961594-57961616 TTAAACCATCCCTGCATCCTTGG - Intergenic
1097607416 12:61772534-61772556 TTAAACCATCCCTGCATCCCTGG - Intronic
1098060723 12:66559000-66559022 TTAAACCATCCTTGCACCCCTGG - Intronic
1098156559 12:67605509-67605531 TTACACCACCACTGAAACACAGG - Intergenic
1098491005 12:71078005-71078027 TTAAACCATCCCTGCATCCCTGG - Intronic
1098499937 12:71179837-71179859 TTAAAACATCCCTGCATCCCTGG - Intronic
1098852551 12:75614426-75614448 TTAAACTATCCCTGCATCCCTGG - Intergenic
1098960434 12:76734588-76734610 TTAAACCATCCCTGCCTCCCTGG + Intergenic
1098982354 12:76970869-76970891 TCAAACCATCTCTGCATCCCAGG + Intergenic
1099090406 12:78299729-78299751 TGATACCATCACTACAGTCCAGG - Intergenic
1099392111 12:82094448-82094470 TAAAACCATCCCTGCATCCCTGG + Intergenic
1099516776 12:83606385-83606407 TTAAACCATCCCTGAAGCCCTGG - Intergenic
1099590899 12:84588327-84588349 TTGAACCATCATTGCATCCCAGG - Intergenic
1099605209 12:84795182-84795204 TGCCACCATAACTGCAGCCCGGG + Intergenic
1099777115 12:87147957-87147979 TTAAACCATCCCTGCATCTCTGG + Intergenic
1100059219 12:90552305-90552327 TTAAACCATCCCTGCATCTCTGG + Intergenic
1100087826 12:90933240-90933262 TTAAACCATCCCTGCATCCCTGG + Intronic
1100203221 12:92321771-92321793 TTAAACCATCCCTGCATCCCTGG + Intergenic
1100706610 12:97207196-97207218 TTAAATCATCTCTGCATCCCTGG - Intergenic
1100920724 12:99483319-99483341 TTAAACCATCCCTGCATCCCTGG + Intronic
1100937314 12:99683797-99683819 TTGAACCATCCCTGCATCCCTGG - Intronic
1101024472 12:100587405-100587427 TTAAACCATCCTTGCATCCCTGG - Intronic
1101634948 12:106532093-106532115 TTAAACCATCCCTGCATCTCTGG + Intronic
1102270318 12:111529027-111529049 TGCCGCAATCACTGCAGCCCTGG + Intronic
1102497014 12:113326874-113326896 GCACACCATCACTCCAGCCTGGG - Intronic
1102916399 12:116756647-116756669 TTAAACCATCCCTGCATCCCTGG + Intronic
1104103587 12:125638103-125638125 TTACTGCTTCAGTGCAGCCCAGG - Intronic
1104181056 12:126381186-126381208 TTAAACCATCTCTGCATCCCTGG - Intergenic
1104491914 12:129201543-129201565 TGAGCCCAGCACTGCAGCCCAGG - Intronic
1104741749 12:131181550-131181572 TTAAACCATCCCTGAATCCCTGG - Intergenic
1105209736 13:18250592-18250614 CTAAACAATCACTGCAGCCCAGG - Intergenic
1105275012 13:18913382-18913404 TTAAACTATCCCTGCATCCCTGG - Intergenic
1105314793 13:19248045-19248067 TTAAACCATCCCTGCATCCCTGG - Intergenic
1105471040 13:20694921-20694943 TTATACAAAAACTGCAGCCCAGG + Intergenic
1105534508 13:21252030-21252052 TTAAACCATCCTTGCATCCCAGG - Intergenic
1105598565 13:21863792-21863814 TTAAATCATCCCTGCATCCCTGG + Intergenic
1105931118 13:25053170-25053192 TTAAACCATCCCTGCATCCCTGG - Intergenic
1106411375 13:29513836-29513858 TGACACCATGACAGCTGCCCGGG - Exonic
1106424854 13:29617355-29617377 TTAAACCACCCCTGCATCCCTGG - Intergenic
1106921088 13:34563779-34563801 TTAAACCATCCCTGCATCCCTGG - Intergenic
1106937841 13:34743920-34743942 TTAAACCATTCCTGCATCCCTGG + Intergenic
1107095904 13:36534933-36534955 TTCCACCCTCTCTCCAGCCCTGG + Intergenic
1107109705 13:36683645-36683667 TTACACAATAACTGCAGCAGAGG + Intronic
1107251635 13:38370661-38370683 TTAAACCGTCCCTGCATCCCTGG + Intergenic
1107361499 13:39622792-39622814 TCAAACCATCCCTGCATCCCTGG - Intergenic
1107701604 13:43054220-43054242 TTAAACTATCTCTGCATCCCTGG + Intronic
1107755662 13:43619570-43619592 TTAAACCATCCCTGCATCCCTGG + Intronic
1107827998 13:44347622-44347644 TGAGACCATCACTTGAGCCCAGG - Intergenic
1108298382 13:49049127-49049149 TTAAGCCATCCCTGCATCCCTGG + Intronic
1108456931 13:50625441-50625463 TTAAATCATCTCTGCATCCCTGG - Intronic
1108469150 13:50751249-50751271 TTAAACCATCCCTGCATCCCTGG + Intronic
1108825879 13:54411616-54411638 TTAAACCATCCCTGCATCCCTGG - Intergenic
1109125446 13:58511908-58511930 TTAAACCACCCCTGCATCCCTGG - Intergenic
1109213293 13:59559917-59559939 TTAAACCATCCCTGCATCCTTGG + Intergenic
1109220527 13:59636750-59636772 TTGCACCATCCCTGTAGCTCAGG + Intergenic
1109420232 13:62102308-62102330 TTGAACCATCATTGCATCCCTGG + Intergenic
1109503486 13:63268518-63268540 TTAAACCATCCCTGCATCCCTGG - Intergenic
1109504637 13:63284547-63284569 TTACACCATCCCTGCATCCTTGG + Intergenic
1109508064 13:63333219-63333241 TTAAACCATCCCTGCATCCCTGG + Intergenic
1109596798 13:64566855-64566877 TTAAACCATCCCTGCATCCCTGG + Intergenic
1109617917 13:64861351-64861373 TTAAACCATCCCTGTATCCCTGG + Intergenic
1109824511 13:67700288-67700310 TTAAGCCATCCCTGCATCCCTGG - Intergenic
1109905952 13:68842117-68842139 TCAAACCATCATTGCACCCCTGG - Intergenic
1109924774 13:69122006-69122028 TTAAACCAACCCTGCATCCCTGG - Intergenic
1109945658 13:69428110-69428132 TTTAACCATCCCTGCATCCCTGG - Intergenic
1110340344 13:74383334-74383356 TTAAACCATCTCTGCATCCCTGG + Intergenic
1110577576 13:77077243-77077265 TTTCACCATCTTTCCAGCCCAGG + Exonic
1110748372 13:79082879-79082901 TTAAACCATTCCTGCATCCCTGG - Intergenic
1110756054 13:79175497-79175519 TTAAACCATCCCTGCATCCCTGG - Intergenic
1111053265 13:82913743-82913765 TTATACCATCATTGCATCCCTGG - Intergenic
1111148779 13:84220232-84220254 TTAAACAATCCCTGCATCCCTGG - Intergenic
1111160584 13:84390007-84390029 TTAAACCACCCCTGCATCCCTGG + Intergenic
1111165448 13:84452133-84452155 TTAAACCAACCCTGCATCCCTGG + Intergenic
1111283320 13:86055361-86055383 TTAAACCATCCCTGCATCCCTGG - Intergenic
1111988739 13:95093363-95093385 TTAAACCATCTCTACATCCCTGG - Intronic
1112137581 13:96598985-96599007 TTGAACCATCCCTGCATCCCTGG + Intronic
1112654820 13:101440126-101440148 TTAAATCATCCCTGCATCCCTGG - Intergenic
1112738444 13:102447157-102447179 TTAAACCATCCCTTCATCCCTGG - Intergenic
1112747635 13:102544868-102544890 TTAAACCATCCCTGCATCTCTGG - Intergenic
1112752440 13:102596803-102596825 CTCCCCCTTCACTGCAGCCCGGG + Intergenic
1112945638 13:104923472-104923494 TTAAACCATCCCTGCATCCCTGG - Intergenic
1113183113 13:107654820-107654842 TTAAACCATTCCTGCAGCCCTGG - Intronic
1113330383 13:109320832-109320854 TTAAACCATCCCTGCATCCCTGG - Intergenic
1113340142 13:109414771-109414793 TTTAACCACAACTGCAGCCCAGG + Intergenic
1113534607 13:111055392-111055414 TTAAACCATCCCTGCATCCCTGG + Intergenic
1113575034 13:111389267-111389289 TTGGACCATAACTCCAGCCCAGG - Intergenic
1113637835 13:111933158-111933180 TTGAACCATCCCTGCATCCCTGG + Intergenic
1113845262 13:113384836-113384858 TTAAACCATCCCTGCATCCCTGG + Intergenic
1113954691 13:114091531-114091553 TTAAACCATCCCTGCATTCCTGG + Intronic
1114905356 14:27120269-27120291 TGACACCATCAGTGCAGGCTGGG + Intergenic
1115299644 14:31869646-31869668 TTAAACCATCCCTGCATCCTTGG - Intergenic
1115350321 14:32387662-32387684 TTAAACCATCCCTGCATCCCTGG + Intronic
1115392917 14:32873943-32873965 TTAAACCATCCCTGCATCACTGG + Intergenic
1115937815 14:38574561-38574583 TTAAACCATCCCTGCATCCCTGG + Intergenic
1115959005 14:38813575-38813597 TTAAAACATCCCTGCATCCCTGG - Intergenic
1115997352 14:39208372-39208394 TTAAACCATCCCTGCATCCCTGG - Intergenic
1116048729 14:39777789-39777811 TTAAACCATCCCTGCATTCCTGG + Intergenic
1116223645 14:42119527-42119549 TTAAACCATCGCTGCATCCCTGG - Intergenic
1116335815 14:43654952-43654974 TTAAACCACCTCTGCATCCCTGG - Intergenic
1116347071 14:43807305-43807327 TTAAACCATCCCTGCATCCCTGG - Intergenic
1116450252 14:45056684-45056706 TTAAACCATCCTTGCATCCCTGG + Intronic
1116695244 14:48166983-48167005 TTAAACCATCCCTGCATCCCTGG - Intergenic
1116918885 14:50551696-50551718 TTAAACCATCCCTGAATCCCTGG - Intronic
1117182549 14:53206366-53206388 TTAAAACATCCCTGCATCCCTGG - Intergenic
1117509809 14:56439401-56439423 TTAAATCATCCCTGCATCCCTGG + Intergenic
1117768841 14:59111508-59111530 TTAAATCATCCCTGCATCCCTGG - Intergenic
1118061834 14:62147603-62147625 TTAAACCATCCCTGCATTCCTGG - Intergenic
1118196899 14:63635300-63635322 TTAAACCATCCCTGCATTCCTGG - Intronic
1118423799 14:65635653-65635675 TTAAACCATCCCTGCATCCCTGG + Intronic
1118531803 14:66714795-66714817 TTAAACCATCCCTGCATCCCTGG + Intronic
1118838918 14:69496583-69496605 TCACACCACCACTGCACTCCAGG - Intronic
1119098786 14:71859773-71859795 TTAAACCATCCCTGCATCCCTGG - Intergenic
1119354535 14:73994686-73994708 TTGCACCAGCACTCCAGCCTGGG + Intronic
1120450639 14:84662519-84662541 TTATACCATCCCTGTATCCCTGG + Intergenic
1120776404 14:88442608-88442630 TTAAACCATCCCTGCAGCCCTGG + Intronic
1121439709 14:93941033-93941055 TTTTACCTTCACTTCAGCCCTGG + Intronic
1121460188 14:94069683-94069705 TTAAACCATCCCTGCATCCCTGG - Intronic
1121516274 14:94552995-94553017 TTAAACCATCCCTGCATCTCTGG + Intergenic
1121647653 14:95530912-95530934 TTAGAGCATCACTGCAACCCTGG - Intergenic
1121848142 14:97193093-97193115 TTAAACCATCCCTGCATACCTGG + Intergenic
1121959194 14:98243052-98243074 TTCCCTCATCACTGCAACCCTGG - Intergenic
1122195809 14:100084707-100084729 GTAGACCATCACGGAAGCCCGGG - Exonic
1123103939 14:105827933-105827955 TTAAACCATCCCTGCATCTCTGG + Intergenic
1123657046 15:22528462-22528484 TTGCACCACCACTGTAGCCTGGG + Intergenic
1124381044 15:29165993-29166015 TTAAACCATCCCTGCATCCCTGG - Intronic
1124386434 15:29211797-29211819 TTAAACCATTTCTGCATCCCTGG + Intronic
1124806824 15:32892377-32892399 TAAAACCATCCCTGCATCCCTGG + Intronic
1125269039 15:37917947-37917969 TTAAACCATCCCTGCATCCCTGG + Intergenic
1125273142 15:37962357-37962379 TTAAACCATCTCTGCATCCCTGG + Intronic
1126060196 15:44773499-44773521 TTAAACCATCCCTGTATCCCTGG + Intergenic
1126127511 15:45309096-45309118 ATAGGGCATCACTGCAGCCCAGG - Intergenic
1126184360 15:45816835-45816857 TTAAACCATCCCTGCATCCCTGG + Intergenic
1126190866 15:45877128-45877150 TTAAACCATCCCTGCATCCCTGG - Intergenic
1126488245 15:49207156-49207178 TTAAACCATCCCTGCATCCCTGG + Intronic
1126503719 15:49379114-49379136 TTGAACCATCCCTGCATCCCTGG + Intronic
1126504395 15:49387315-49387337 TTAAACCATCCCAGCATCCCTGG - Intronic
1126521792 15:49603970-49603992 TTGAACCATCCCTGCATCCCTGG + Intronic
1126566235 15:50102915-50102937 TTAAACCATCCCTGCATCCCTGG - Intronic
1126573409 15:50173965-50173987 TGAAACCATCCCTGCATCCCCGG - Intronic
1126577863 15:50214640-50214662 TGAAACCATCCCTGCATCCCTGG - Intronic
1126642602 15:50842832-50842854 TTAAACCACCCCTGCATCCCTGG - Intergenic
1126876689 15:53050512-53050534 TTACTCCACCACAGAAGCCCAGG - Intergenic
1126977594 15:54201486-54201508 TTAAACCATCCCTGCATTCCTGG - Intronic
1127007880 15:54591111-54591133 TTACACTATCCCTGCATCCCTGG + Intronic
1127090589 15:55462766-55462788 TTAAACCAGCCCTGCATCCCTGG - Intronic
1127194786 15:56572205-56572227 TTAAAACATCCCTGCATCCCTGG - Intergenic
1127226634 15:56937871-56937893 TTAAACCATCCCTGTATCCCTGG + Intronic
1127573657 15:60268994-60269016 TTAAACCGTCTCTGCATCCCTGG + Intergenic
1128365905 15:67002687-67002709 TCAAATCATAACTGCAGCCCTGG + Intergenic
1128415380 15:67440540-67440562 TTAAACCATCCCTGCATCCCTGG - Intronic
1128763421 15:70235403-70235425 TTCCTCCAGCACTGCAGCCCTGG - Intergenic
1129584102 15:76845048-76845070 TTAAACCATCCATGCATCCCTGG - Intronic
1129627545 15:77218452-77218474 TTAAACCAACACTGCAACCCTGG + Intronic
1129818035 15:78573290-78573312 TTCCAACAGCACTGCAGCTCTGG - Intronic
1130405886 15:83601515-83601537 TTAAACCATCCCTGCATCCCTGG + Intronic
1130419265 15:83726711-83726733 TTAAACCATCCTTGCATCCCTGG + Intronic
1130605211 15:85309654-85309676 TTAAACCATCCCTGCACCCCTGG - Intergenic
1130810547 15:87373140-87373162 TTAAACCATCCTTGCATCCCTGG + Intergenic
1131230048 15:90653139-90653161 GGACACCAGCTCTGCAGCCCAGG - Intergenic
1131414255 15:92238937-92238959 TTAAATCATCCCTGCATCCCTGG - Intergenic
1132209976 15:100013703-100013725 TTAAATCATCCCTGCATCCCTGG + Intronic
1132341316 15:101080083-101080105 CTACCCCAGCTCTGCAGCCCTGG + Intergenic
1133575523 16:7085499-7085521 ATTCACCACCACTGCATCCCGGG + Intronic
1134120866 16:11584302-11584324 TTCCACCCTCACTGTAGCTCTGG + Intronic
1134232312 16:12438426-12438448 TTACCCGCTCACTCCAGCCCAGG + Intronic
1135203162 16:20457486-20457508 TTAAACCATTCCTGCATCCCTGG - Intronic
1135215940 16:20570380-20570402 TTAAACCATTCCTGCATCCCTGG + Intronic
1137498622 16:48993299-48993321 TCACACCAGCACTCCAGCCTGGG - Intergenic
1138746926 16:59374448-59374470 TTAAACCAGCCCTGCATCCCTGG + Intergenic
1138779999 16:59772296-59772318 TTTCCCCATCACTGCAGCCAAGG - Intergenic
1139419076 16:66837747-66837769 TTAAACCATCCCTGCAACCCTGG - Intronic
1139987580 16:70912428-70912450 TTAAACCATCCCTGAATCCCTGG + Intronic
1140019286 16:71222158-71222180 TTAAACCATCCCTGCATTCCTGG - Intronic
1140064298 16:71597243-71597265 TTAAACCATCCCTGCTTCCCTGG - Intergenic
1140220349 16:73039358-73039380 AGACACCTTCACTGCAGCCTGGG - Intronic
1140463216 16:75158389-75158411 TCACTCCAGCACTGCAGCCTGGG - Intronic
1140620001 16:76718213-76718235 TTAAACCACCCCTGCATCCCTGG - Intergenic
1140669250 16:77259111-77259133 TTAAACCATCCTTGCAACCCTGG + Intronic
1142938035 17:3353997-3354019 TTGCACCATCTTTGCATCCCTGG + Intergenic
1142939358 17:3369550-3369572 TTAAACCATCCTTGCATCCCTGG + Intergenic
1143277884 17:5727191-5727213 TTAAACCATCCCTGCATCCCTGG - Intergenic
1144139347 17:12333146-12333168 TTAAACCATCCCTGCATCCCTGG + Intergenic
1144407864 17:14969902-14969924 TTAAACCATCCTTGCATCCCTGG + Intergenic
1144616425 17:16778925-16778947 TTAAACCATCCCTGCATCCCTGG - Intronic
1144896272 17:18536728-18536750 TTAAACCATCCCTGCATCCCTGG + Intergenic
1145135942 17:20407486-20407508 TTAAACCATCCCTGCATCCCTGG - Intergenic
1146269203 17:31473447-31473469 TGGGAGCATCACTGCAGCCCAGG + Intronic
1146745639 17:35326478-35326500 TTAAACCATCCCTGCATCCCTGG + Intergenic
1146751011 17:35380508-35380530 TTAAACCATGCCTGCATCCCTGG + Intergenic
1147517034 17:41128670-41128692 TTAAACCATCCCTGCATCCCTGG - Intergenic
1147593531 17:41701504-41701526 TTACCCAGTCACAGCAGCCCGGG - Intergenic
1148151637 17:45400068-45400090 TGACAGCATCACTTCAGTCCAGG + Intronic
1148407924 17:47436092-47436114 TTAAACTATCCCTGCATCCCTGG + Intronic
1149022467 17:51985187-51985209 TTAAACCATCCCTCCATCCCTGG - Intronic
1149122086 17:53181706-53181728 TTAAACCATCCCTCCATCCCTGG + Intergenic
1149393117 17:56212358-56212380 TGAAACCATCCCTGCATCCCTGG + Intronic
1149410588 17:56402012-56402034 TTAAACCATCTCTGCATCCCTGG + Intronic
1150093085 17:62347248-62347270 TTAAACCATCACTGCATCCCTGG + Intergenic
1150945167 17:69737831-69737853 TTAAACCATCCCTGCATCCTTGG + Intergenic
1151048704 17:70951295-70951317 TTAAACCATCCCTGCCTCCCTGG - Intergenic
1151458734 17:74242178-74242200 TTTCCCCATCAGTCCAGCCCTGG + Intronic
1151700974 17:75742467-75742489 CTACACCCTCACTGCAGACCAGG + Exonic
1152031465 17:77845958-77845980 TGACACCTTCCCTGCAGCCCCGG - Intergenic
1153065775 18:1043185-1043207 TTAAACCATCCCTGCATCTCTGG - Intergenic
1153069175 18:1085867-1085889 TTAAACCATCCCTGCATCCCTGG + Intergenic
1153139560 18:1955269-1955291 CTACACCATCCCTGCAGCAGCGG + Intergenic
1153176004 18:2374086-2374108 TTAAATCATCCCTGCAACCCTGG + Intergenic
1153221567 18:2867016-2867038 TGAAACCATCCCTGCATCCCTGG + Intronic
1153269063 18:3301023-3301045 TTGAACCATCCCTGCATCCCTGG - Intergenic
1153396091 18:4622548-4622570 TTTAACCATCTCTGCATCCCTGG + Intergenic
1153402191 18:4693165-4693187 TTAAACCATCCCTGCATCCCTGG - Intergenic
1153440592 18:5114299-5114321 TTCCACCATCATTGCATTCCTGG + Intergenic
1153451055 18:5229464-5229486 TTAAGCCATCCCTGCATCCCTGG + Intergenic
1153532696 18:6065168-6065190 TTAAACCATACCTGCAACCCTGG + Intronic
1153536563 18:6108239-6108261 GAACAACATCACTGCAGCCAGGG + Intronic
1153702437 18:7710218-7710240 TTAAGCCATCCCTGCATCCCTGG - Intronic
1154298238 18:13169656-13169678 CTAAACCATCCCTGCATCCCTGG - Intergenic
1155286755 18:24296819-24296841 TTAAAGCATCCCTGCATCCCTGG + Intronic
1156095695 18:33529195-33529217 TTAAACCATCCCTGCATCCTTGG + Intergenic
1156327018 18:36083598-36083620 TTAAACCATCCCTGCATCCCTGG - Intergenic
1156667800 18:39429099-39429121 TTAAACCATCCCTGCATCTCTGG - Intergenic
1156790571 18:40968247-40968269 TTAAACCATCCCTCCATCCCTGG - Intergenic
1156976386 18:43226354-43226376 TTAAACCATCCCTGCATCCCTGG - Intergenic
1157507801 18:48242521-48242543 TTAAACCATCCCTGCATCCCAGG - Intronic
1157541175 18:48508805-48508827 TTAAACCAGCCCTGCATCCCTGG - Intergenic
1158002936 18:52640036-52640058 TTAAACCATCCCTGCATCCCTGG - Intronic
1158112270 18:53953505-53953527 TTAAACCATCCCTGTACCCCTGG - Intergenic
1158331345 18:56366642-56366664 TTAAACCATCCCTGCATCACTGG + Intergenic
1158338441 18:56438609-56438631 TTAAACCATCCCTGCATCCCTGG - Intergenic
1158475838 18:57778583-57778605 TCACACCTTGACTGCAGCCTTGG - Intronic
1158756826 18:60335247-60335269 TTAAACCATCCCTGCATCCCTGG - Intergenic
1159430726 18:68349578-68349600 TTAAATCATCCCTGCATCCCTGG - Intergenic
1159612561 18:70542608-70542630 TTGAACCATCCCTGCATCCCTGG + Intergenic
1159943933 18:74429630-74429652 TTAAACCCTCACAACAGCCCTGG + Intergenic
1160219486 18:76963393-76963415 TTAAACCATTCCTGCATCCCTGG + Intronic
1160475868 18:79187268-79187290 TTTCACCCTCACAGTAGCCCAGG + Intronic
1161934149 19:7360910-7360932 TTCCACCATCACTGCTTTCCAGG - Intronic
1162052306 19:8041933-8041955 TAACACCAGCACTCCAGCCTGGG + Intronic
1163015345 19:14451124-14451146 CTACCCCACCCCTGCAGCCCTGG + Intronic
1163915540 19:20237827-20237849 TTGCACCACCACTCCAGCCTGGG - Intergenic
1164096582 19:22015511-22015533 TTAAATCATCTCTGCATCCCTGG + Intergenic
1164116085 19:22220137-22220159 TTAAATCATCTCTGCATCCCTGG + Intergenic
1164125383 19:22310520-22310542 TTAAACCATCCCTGCATCACTGG + Intronic
1164174831 19:22762806-22762828 TTAAACCATCCCTGCATCACTGG - Intronic
1164199783 19:23007637-23007659 TTAAATCATCTCTGCATCCCTGG + Intergenic
1164238000 19:23354288-23354310 TTAAACCATCCCTGCATACCTGG - Intronic
1164267794 19:23637089-23637111 TTAAACCAACCCTGCATCCCTGG - Intronic
1164298895 19:23941298-23941320 TTAAACCATCCCTGCATCCCTGG + Intronic
1164319812 19:24133769-24133791 TCAAACCATCCCTGCATCCCTGG + Intergenic
1164422695 19:28110147-28110169 TTAAACAATCCCTGCATCCCTGG - Intergenic
1165866425 19:38942304-38942326 TTTCACCACCACTCCAGCCTGGG - Exonic
1166263026 19:41655868-41655890 TTAAACCATCCCTGCATCCCTGG - Intronic
1166569415 19:43784456-43784478 TAACCCCATCACTGCCACCCAGG - Intergenic
1166603921 19:44123311-44123333 TTAAACCATCCCTGCATCCCTGG + Intronic
1166617876 19:44267394-44267416 TTGCACCACCACTTCAGCCTAGG - Intronic
924974739 2:162258-162280 TCACACCAGCACTTCAGCCAAGG + Intergenic
925127093 2:1466210-1466232 TTAAGCCATCCCTGCATCCCTGG + Intronic
925447670 2:3941859-3941881 TTAAACCATCCCTGCATCCCTGG + Intergenic
925698541 2:6609629-6609651 TTAAACCAACCCTGCATCCCTGG + Intergenic
926560496 2:14411837-14411859 TTAAACCATCTCTGCACCCTTGG - Intergenic
927024785 2:19055579-19055601 TTAAACCATCCCTGCAGCCATGG + Intergenic
927036405 2:19181783-19181805 TTAAACCGTCCCTGCATCCCTGG + Intergenic
927069608 2:19513444-19513466 TTAAACTATCCCTGCATCCCTGG + Intergenic
927080251 2:19620855-19620877 GTAAACCATCACTGCATCCCTGG - Intergenic
928019445 2:27690842-27690864 TTAAACCATCCCAGCATCCCTGG + Intronic
928734032 2:34264815-34264837 TTAAACCATCTCTACATCCCTGG - Intergenic
928772199 2:34716284-34716306 TTAAACCATCCATGCATCCCTGG + Intergenic
929009963 2:37431691-37431713 TTAAAACATCCCTGCATCCCTGG + Intergenic
929040114 2:37736451-37736473 TAACAGGATCACTGGAGCCCAGG + Intronic
929104743 2:38353761-38353783 TCACATCATCACTGAAGCACTGG + Intronic
929197400 2:39199660-39199682 TTAAACCATCCCTGCATCCCTGG - Intronic
929399001 2:41558189-41558211 TTAAACCAACTCTGCATCCCTGG - Intergenic
929670405 2:43872664-43872686 TTGCACCTTCACTCCAGCCTAGG + Intronic
929806182 2:45147140-45147162 TTAAGCCATCCCTGCATCCCTGG - Intergenic
930142934 2:47971547-47971569 TTAAACCATCCTTGCATCCCTGG - Intergenic
930395443 2:50817678-50817700 TTGAACCATCCCTGCAACCCAGG - Intronic
930486198 2:52014443-52014465 TTAAACCATCCCTGGATCCCTGG + Intergenic
930574003 2:53123923-53123945 TTAAACTATCCCTGCATCCCTGG + Intergenic
930657878 2:54024410-54024432 TTAAACCATCCCTGCATCCCTGG - Intronic
930818705 2:55624088-55624110 TAACACCATCACCACATCCCAGG - Intergenic
931136291 2:59405471-59405493 TTAAACCATCCCTGCATCCTTGG - Intergenic
931524823 2:63141433-63141455 TTAAACCATCCCTACATCCCTGG + Intronic
931548195 2:63412201-63412223 TTAAACCATCCCTGCATCCCTGG - Intronic
931834942 2:66089078-66089100 TTAAACCATCCCTGCATCCCTGG - Intergenic
932384559 2:71319739-71319761 TTAAACCATCCCTGCATTCCTGG + Intronic
932473431 2:71980892-71980914 TTAAACCATCCCTGCATCCCTGG - Intergenic
932648156 2:73527088-73527110 TTAAACCATCCTTGCATCCCTGG + Intronic
932653656 2:73587596-73587618 TTAAGCCATCCCTGCATCCCTGG + Intronic
932814944 2:74853975-74853997 TGACAACATCACTGGAGCCAGGG - Intronic
932870967 2:75397358-75397380 TTAAAGCATCCCTGCATCCCTGG - Intergenic
932883956 2:75530574-75530596 TTAAACCATCCCTGTATCCCTGG - Intronic
933019126 2:77168900-77168922 TTAAACCATCCTTGCATCCCTGG - Intronic
933411085 2:81925820-81925842 TTAAACCATCCTTGCATCCCTGG - Intergenic
933433172 2:82211361-82211383 TTAAACCATCCCTGCATCCCTGG + Intergenic
933474649 2:82774305-82774327 TTAAACCATCCCTGCATCCCTGG - Intergenic
934111068 2:88743355-88743377 TTAAACCATCCCTGCATCCCTGG + Intronic
935439672 2:103077538-103077560 TTCAACCATCCCTGCATCCCTGG + Intergenic
935467427 2:103415649-103415671 TTAAACCATTCCTGCATCCCTGG - Intergenic
935808056 2:106768327-106768349 TTAAACCATCCCTGCAACCCTGG - Intergenic
935954330 2:108360558-108360580 TTAAACCATCCCTGCATCCCTGG - Intergenic
936555231 2:113491144-113491166 TTAAACCATCCCTGCATCCCTGG - Intronic
936776502 2:115980570-115980592 TTAAACCATCCCTGCATCTCTGG + Intergenic
936815228 2:116452408-116452430 TTAAACTATCCCTGCATCCCTGG + Intergenic
936818131 2:116484997-116485019 CTACACCATGCCTGCTGCCCAGG + Intergenic
936894878 2:117416093-117416115 TTAAACCATCCCTGCATCACTGG + Intergenic
937068922 2:119046975-119046997 TTAAACCATCCCTGCATCCCTGG + Intergenic
937090443 2:119202676-119202698 TTAAACCATTTCTGCAGCCCAGG + Intergenic
937529634 2:122812333-122812355 TTAAACCATCCCTGCATCCCTGG - Intergenic
937561342 2:123228107-123228129 TTCAACCATCCCTGCATCCCTGG - Intergenic
937663323 2:124455737-124455759 TTAAACCATCCCTGCATCCCTGG - Intronic
937699236 2:124845299-124845321 TTAAACCATCCCTGCATTCCTGG + Intronic
937971701 2:127554400-127554422 TTAAACCATCCCTGCATCCCTGG + Intronic
938509756 2:131928243-131928265 TTAAACCATCCCTGCATCCCTGG - Intergenic
938597936 2:132808075-132808097 TTAAACCATCCCTGCACTCCTGG + Intronic
938674857 2:133621956-133621978 TTAAACCACCCCTGCATCCCTGG - Intergenic
938996723 2:136687007-136687029 TTAAACCATCCCTGCATCCCTGG - Intergenic
939219631 2:139285069-139285091 TTAAACCATCCCTGCATACCTGG - Intergenic
939449509 2:142355262-142355284 TTAAACCATCCCTGGATCCCTGG - Intergenic
939909854 2:147967011-147967033 TTAAACCATCCTTGCATCCCTGG - Intronic
939919436 2:148090514-148090536 TTAAACCATCCCTGCATCCCTGG - Intronic
940034388 2:149298367-149298389 TTAAACCATCTCTGCATCCCTGG + Intergenic
940172054 2:150839710-150839732 TTAAACCATCCCTGCATCCCTGG + Intergenic
940365936 2:152848966-152848988 TTAAACCATCCCTGCATCCCTGG + Intergenic
940578024 2:155539136-155539158 TGAAACCATCCCTGCATCCCTGG - Intergenic
940618367 2:156080431-156080453 TTAAACCATCCCTGCATCCCTGG + Intergenic
940762713 2:157754931-157754953 CTAAACCATCCCTGCATCCCTGG - Intronic
940796511 2:158085821-158085843 TTAAACCATCCCTGCATCCCTGG + Intronic
940802571 2:158149105-158149127 TTAAACCATCCCTGCATCCCTGG - Intergenic
941060968 2:160846551-160846573 TTACGCCATCTCTGCATCTCTGG - Intergenic
941230151 2:162901919-162901941 TTAAACCATCCCTGCATCCTTGG - Intergenic
941419452 2:165264275-165264297 TTTAACCATCCCTGCATCCCTGG - Intronic
941419732 2:165268358-165268380 TTAAACCATCCCTGCATCCCGGG - Intronic
941593640 2:167449911-167449933 TTAAACCATCCCTGCATTCCTGG + Intergenic
941679950 2:168386904-168386926 TTAAACCATCCCTGCATCCCTGG - Intergenic
942405626 2:175651372-175651394 TTAAACCATCCCTGAATCCCTGG - Intergenic
942882388 2:180876790-180876812 TTAAACCATCCCAGCAACCCTGG - Intergenic
943122573 2:183755282-183755304 TTAAACCATCCCTGCATCCTTGG - Intergenic
943127908 2:183818988-183819010 TAAAACTATCACTGCATCCCTGG + Intergenic
943131270 2:183855892-183855914 TTAAACCATTCCTGCATCCCTGG - Intergenic
943149627 2:184095741-184095763 TTAAACCATCCCTTCACCCCAGG + Intergenic
943164568 2:184304099-184304121 TTAGACCATCCCTGGAGGCCAGG - Intergenic
943167758 2:184352023-184352045 TTAAATCATCCCTGCATCCCTGG - Intergenic
943243154 2:185413385-185413407 TTAAACCAGCATTGCATCCCAGG + Intergenic
943250245 2:185511552-185511574 TTAAACCATCCCTGCCTCCCTGG + Intergenic
943430525 2:187795170-187795192 TTGAACCATCCCTGCATCCCAGG - Intergenic
943521789 2:188960887-188960909 TTAAACCATCCCTGCATCCCTGG + Intergenic
943580630 2:189679774-189679796 TTAAACCATCCCTTCATCCCTGG + Intronic
943621005 2:190148325-190148347 TTAAACCATTCCTGCATCCCTGG + Intronic
943654601 2:190494671-190494693 TTAAACCATTCCTGCATCCCTGG - Intronic
943890980 2:193286865-193286887 TTAAACCATCCCTGCACTCCTGG + Intergenic
943996397 2:194771656-194771678 TTAAACCATCCCTGCATTCCTGG + Intergenic
944027849 2:195193214-195193236 TTCCACCATCCATGCATCCCTGG - Intergenic
944262766 2:197695116-197695138 TTAAACCATTCCTGCATCCCTGG + Intronic
944373122 2:199010088-199010110 TTAAACCATCCTTGCATCCCTGG + Intergenic
944431714 2:199640985-199641007 TTAAACCATCCTTGCATCCCTGG + Intergenic
944528572 2:200645388-200645410 TTAAACCATCCCTGTATCCCTGG + Intronic
944603327 2:201325989-201326011 TTAAACCATCCCTGCCTCCCTGG - Intronic
944919177 2:204393399-204393421 TTGAACCATCTTTGCAGCCCTGG + Intergenic
945075470 2:206034415-206034437 TTAAACCATCTCTGCATCCCTGG - Intronic
945131692 2:206580536-206580558 TTAAACCATTCCTGCATCCCTGG + Intronic
945286052 2:208083024-208083046 TTAAACCATCCCTGCACGCCTGG - Intergenic
945337729 2:208613016-208613038 TTAAACCATCCCTGAATCCCTGG + Intronic
945387315 2:209218143-209218165 TTAAACCATCCCTGCATCCCTGG - Intergenic
945536263 2:211021713-211021735 TTAAACCATCCCTGAATCCCTGG + Intergenic
945826072 2:214721425-214721447 TTAAACCATCCCTGCATCCCTGG - Intergenic
945838751 2:214863538-214863560 TTGAACCATCATTGCATCCCAGG - Intergenic
945861345 2:215126114-215126136 TTAAACCATCCCTGCATCCCTGG + Intronic
946036800 2:216749696-216749718 TTAAAACATCCCTGCATCCCTGG - Intergenic
946204973 2:218098501-218098523 TTAAATCATCCCTGCATCCCTGG + Intergenic
946501614 2:220253561-220253583 TTAAACCATCCCTGCATCCCTGG - Intergenic
946570889 2:221022998-221023020 TTAAACCATCCCTGCATCCTTGG + Intergenic
946795707 2:223349971-223349993 TTAAACTATCCCTGCATCCCTGG - Intergenic
946824368 2:223661484-223661506 TTAAACCATCCCTGCATCCCTGG - Intergenic
946874835 2:224117768-224117790 TTGAACCATCCCTGCATCCCCGG - Intergenic
946912086 2:224473881-224473903 TTACATCAACACTGAAGACCTGG + Exonic
947146609 2:227072723-227072745 TTAAACCATCCCTACATCCCTGG - Intronic
947456740 2:230261772-230261794 TTAAGCCATCCCTGCATCCCTGG + Intronic
948507425 2:238438537-238438559 TTACTCCCTCACTGGAGCACGGG + Intronic
948577065 2:238960264-238960286 TTAAACCATCCCTGCATCCCTGG - Intergenic
948898346 2:240940518-240940540 TTAAACCATCCCTGCATCCCTGG - Intronic
948983224 2:241505602-241505624 CTGCTCCATCACAGCAGCCCCGG + Intronic
1168941540 20:1716476-1716498 TTAAACCATCCCTGCATCCCTGG - Intergenic
1169295784 20:4396873-4396895 TTAAACCATCCTTGCATCCCTGG - Intergenic
1169327947 20:4691581-4691603 TTGAACCATCCTTGCAGCCCTGG + Intronic
1169335825 20:4755833-4755855 TTAAACCATTTCTGCATCCCTGG + Intergenic
1169616200 20:7448591-7448613 TTAAACCATCCCTGCATCCCTGG + Intergenic
1169629013 20:7604861-7604883 TTAAACCATCCTTGCATCCCTGG - Intergenic
1169800811 20:9509510-9509532 TTACAACATCAGAGCACCCCAGG + Intergenic
1169840940 20:9936604-9936626 TTAAACCATCCCTGCATCCCTGG + Intergenic
1169991266 20:11505487-11505509 TTAAACCATCCCTGCATCCCTGG - Intergenic
1170124052 20:12942867-12942889 TTGAACCATCCCTGCATCCCTGG - Intergenic
1170241238 20:14169026-14169048 TTAAACCATCCCTGCATCCCTGG - Intronic
1170241416 20:14170664-14170686 TTAAACCATCCCTGCATCCCTGG + Intronic
1170245460 20:14217326-14217348 TTAAACCATTCCTGCATCCCTGG + Intronic
1170435605 20:16324973-16324995 TTAAACCTTCTCTGCATCCCTGG - Intronic
1170489168 20:16854072-16854094 TTAGATCATCTCTGCATCCCTGG + Intergenic
1170720712 20:18875998-18876020 TTAAACTATCCCTGCATCCCTGG + Intergenic
1170726613 20:18933784-18933806 TTAAACCATCCCTGGATCCCTGG + Intergenic
1170741352 20:19060252-19060274 TTAAACCATCCTTGCATCCCTGG - Intergenic
1171028854 20:21657732-21657754 TTAAACCATCCCTGCATCCCTGG - Intergenic
1171160156 20:22914857-22914879 TTAAACCATCCCTGCATCCCTGG + Intergenic
1171241986 20:23577857-23577879 TTAAATCATCCCTGCATCCCTGG + Intergenic
1171290886 20:23982259-23982281 CTAAACAATCACTGCAGCCCAGG - Intergenic
1172794452 20:37527451-37527473 GACCACCATCTCTGCAGCCCCGG - Intronic
1173568681 20:44061805-44061827 TTAAACCATCCCTGCATCCATGG - Intronic
1174256037 20:49255866-49255888 GAACACCATGACTGCAGCCGAGG - Exonic
1175095718 20:56540023-56540045 TGATACCACCACTGCAGTCCAGG + Intergenic
1175593947 20:60215529-60215551 TAACTCCATCACTGCAGCCATGG + Intergenic
1175767090 20:61599225-61599247 ATTCACCATCTCTGCAGCCAAGG + Intronic
1176045093 20:63088427-63088449 TTACACCACAGCTGCAGCCCAGG - Intergenic
1177329142 21:19633446-19633468 TTAAACCATTCCTGCATCCCTGG - Intergenic
1177749968 21:25268888-25268910 TAAAACCATCCCTGCATCCCTGG - Intergenic
1177847640 21:26309371-26309393 TTAAACCATCACTGCATCCCTGG - Intergenic
1177981773 21:27924155-27924177 TTAAACCATCCCTGAATCCCTGG + Intergenic
1178059782 21:28839043-28839065 TTAAACCATCCCTGAATCCCTGG - Intergenic
1178733183 21:35124120-35124142 TTAAGCCATCCCTGCATCCCTGG - Intronic
1178802049 21:35805092-35805114 TTAAACCATCCCCGCATCCCTGG - Intronic
1178959382 21:37050710-37050732 TTAGACCATCCCTGCATCCCTGG - Intergenic
1179268559 21:39828658-39828680 TTAAACCATCCCTGCATCCCTGG + Intergenic
1179933362 21:44586728-44586750 TTAAACCATCCCTGCATCCCTGG - Intronic
1180040182 21:45273636-45273658 TTAAACCATCCCTGCATCCCTGG - Intronic
1180766530 22:18348807-18348829 CTAAACAATCACTGCAGCCCAGG + Intergenic
1180779783 22:18513571-18513593 CTAAACAATCACTGCAGCCCAGG - Intergenic
1180812499 22:18770892-18770914 CTAAACAATCACTGCAGCCCAGG - Intergenic
1181198656 22:21205139-21205161 CTAAACAATCACTGCAGCCCAGG - Intergenic
1181364118 22:22361505-22361527 TTAAACCATCCCTGCATCCTTGG + Intergenic
1181373350 22:22436182-22436204 TTAAACCATCCCTGCATCCCTGG + Intergenic
1181401082 22:22650661-22650683 CTAAACAATCACTGCAGCCCAGG + Intergenic
1181454602 22:23050438-23050460 TTAAATCATCCCTGCATCCCTGG - Intergenic
1181523944 22:23467555-23467577 TTAAACCATCCCTGCATCCCTGG - Intergenic
1181703053 22:24631741-24631763 CTAAACAATCGCTGCAGCCCAGG + Intergenic
1181717338 22:24741081-24741103 TTAAACCATCCCTGTATCCCTGG - Intronic
1182682692 22:32094159-32094181 TTAAACCATCCCTGCATCCCTGG + Intronic
1182993984 22:34796093-34796115 TTTCACCGTCAGAGCAGCCCCGG + Intergenic
1183048043 22:35237046-35237068 TTAAACCATCCCTGCATCCCTGG + Intergenic
1183249121 22:36716661-36716683 TTATACCACCCCTGCATCCCAGG + Intergenic
1183475680 22:38034591-38034613 TGACACCAGCCGTGCAGCCCTGG + Intronic
1185045602 22:48527268-48527290 TTAGACCCCAACTGCAGCCCAGG + Intronic
1203228149 22_KI270731v1_random:89698-89720 CTAAACAATCACTGCAGCCCAGG + Intergenic
949727515 3:7066844-7066866 TTAAATCATCCCTGCATCCCTGG - Intronic
949749611 3:7336215-7336237 TTAAACCAACCCTGCATCCCAGG - Intronic
949814575 3:8044382-8044404 TTTAACCATCCCTGCATCCCTGG - Intergenic
950588233 3:13912857-13912879 TTAAACCATCCCTGCATCCCTGG - Intergenic
950592076 3:13944503-13944525 TTAAACCATCACTGCATCCCTGG + Intronic
950593950 3:13961863-13961885 TTGAACCATCCCTGCATCCCTGG + Intronic
950819974 3:15746532-15746554 TAACACCATCCATGCACCCCTGG + Intronic
951094458 3:18611852-18611874 TTAAACCATCCCTGCATCCCTGG - Intergenic
951198464 3:19851207-19851229 TTAAACCATCCTTGCATCCCTGG - Intergenic
951260366 3:20500550-20500572 GTAAACCATCCCTGCAACCCTGG + Intergenic
951763917 3:26175789-26175811 TTAAACCATCCCTGCATCCCTGG + Intergenic
951852267 3:27154619-27154641 TTAAACCATCCCTGTATCCCTGG - Intronic
952024246 3:29059159-29059181 TTAAACCATCCCTGCATCCCTGG - Intergenic
952027036 3:29095706-29095728 TTAAACCATCCCTGCATCCCTGG + Intergenic
952097109 3:29967009-29967031 TTAAACCATCCCTGCATCTCTGG + Intronic
952265421 3:31781135-31781157 TTAAACCATCTCTGAATCCCTGG - Intronic
952493424 3:33894289-33894311 TTAAACTATCCCTGCATCCCTGG + Intergenic
952601805 3:35092398-35092420 TTAAACCATCCCTGCATCACTGG - Intergenic
952703578 3:36352371-36352393 TTAAACCATCCCTGCATCCTTGG - Intergenic
952714611 3:36467163-36467185 TTAAACCATCCCTGCATCCCTGG + Intronic
952994108 3:38860562-38860584 TTAAACCATCCCTGCATTCCTGG - Intronic
953185596 3:40635121-40635143 GTAAACCATCCCTGCATCCCTGG - Intergenic
953495564 3:43383507-43383529 TTAAACCATCCCTGCATCCCTGG - Intronic
953495574 3:43383598-43383620 TTAAATCATCCCTGCATCCCAGG - Intronic
953539781 3:43807146-43807168 TTAAACCATCCCTGTATCCCTGG - Intergenic
953639458 3:44692727-44692749 TTAAACCATCCCTGCATCCCTGG - Intergenic
953866801 3:46590720-46590742 TTAAACCACCCCTGCATCCCTGG - Intronic
955175319 3:56607952-56607974 TTAAACCATCCCTGCATCCCTGG + Intronic
955450463 3:59061159-59061181 TTAAACCATCCCTGCATCCCTGG + Intergenic
955859779 3:63316058-63316080 TTAAACCATCCCTGCATCCCTGG + Intronic
957015911 3:75065129-75065151 TTAAATCATCCCTGCATCCCTGG + Intergenic
957772402 3:84711228-84711250 TTAAACCATCTCTGTATCCCTGG - Intergenic
957852886 3:85833135-85833157 CTAAACCATCACTGCATCCCAGG + Intronic
957942331 3:87020891-87020913 TTAAACCAGCCTTGCAGCCCAGG - Intergenic
957971995 3:87394080-87394102 TTAAACCATCTCTCCATCCCTGG - Intergenic
958070423 3:88603639-88603661 TTAAACCATCCCTGCATCACTGG - Intergenic
958509816 3:95033531-95033553 TTAAACCATCCCTGCATCCCTGG + Intergenic
958752727 3:98211533-98211555 TAGCACCATCACTGCAACCTCGG - Intergenic
958768669 3:98400946-98400968 TTAAACCATCTCTTCACCCCAGG - Intergenic
958770986 3:98425379-98425401 TTAAACCATCCCTGCATCCCTGG - Intergenic
959128445 3:102320121-102320143 TTACACCAACCTTGCATCCCAGG + Intronic
959131980 3:102367557-102367579 TTAAACCATCCCTGAATCCCTGG + Intronic
959280203 3:104327819-104327841 TTAAACCATCCCTGCATTCCTGG - Intergenic
959304949 3:104650938-104650960 TTGTACCATCACTGCATCCCAGG + Intergenic
959325410 3:104930413-104930435 TTAAACCATCCCTGCATGCCTGG + Intergenic
959362215 3:105407392-105407414 TTAAACAATCCCTGCATCCCTGG - Intronic
959424126 3:106165081-106165103 TTAAACTATCCCTGCATCCCTGG - Intergenic
959727085 3:109556314-109556336 TTAAACCATCCCTGGACCCCTGG + Intergenic
959745381 3:109770191-109770213 TTAAACCATCCCTGCATCACTGG - Intergenic
959754144 3:109876354-109876376 TTGAACCAACACTGCATCCCAGG - Intergenic
959765575 3:110023150-110023172 TTAAACCATCCCTGTATCCCTGG - Intergenic
959802227 3:110509079-110509101 TTAAACCATCCCTGCATCCCTGG + Intergenic
959899430 3:111643154-111643176 TTAAACCATCCCTGCATCCCTGG - Intronic
960033081 3:113074512-113074534 TTAAACCATCTCTGCATCCCTGG + Intergenic
960516855 3:118611645-118611667 TTAAACCATCCCTGCATCCCTGG - Intergenic
960524753 3:118696714-118696736 TTAAACAATCTCTGCATCCCTGG - Intergenic
960558224 3:119052817-119052839 TTAAACCAACCCTGCATCCCTGG - Intronic
960778547 3:121290728-121290750 TTAAACCATCCCTGCATCCCTGG - Intronic
960782852 3:121339241-121339263 TTGAACCATCCCTGCATCCCTGG - Intronic
960917473 3:122711406-122711428 TTAAACCATCCCTGCATCCCTGG + Intronic
961007110 3:123412466-123412488 CCAAACCATCCCTGCAGCCCTGG - Intronic
961264408 3:125629689-125629711 TTAAACCATCCCTGCATCCCTGG + Intergenic
961407313 3:126689893-126689915 TTAAACCATCCCTGCATCCCTGG + Intergenic
962063432 3:131953537-131953559 TTAAACCATCCTTGCATCCCTGG + Intronic
962147127 3:132851875-132851897 TTAAACCATCCCTGCATCCCTGG + Intergenic
962192187 3:133322839-133322861 TTAAACCATCCCTGCATCCTTGG - Intronic
962447258 3:135478070-135478092 TTAAACCATCCTTGCATCCCAGG + Intergenic
962530137 3:136272179-136272201 TTAAACCATCCCTGCATCTCTGG + Intronic
962651626 3:137499556-137499578 TTAAACCATCCCTGCATCTCTGG + Intergenic
962689027 3:137874535-137874557 TTGAACCATCCCTGCATCCCAGG - Intergenic
962705642 3:138041074-138041096 TTCCACCATCACAGCGGCTCTGG + Intergenic
962780654 3:138712609-138712631 TCACACCACCACTCCAGCCTGGG - Intronic
963017609 3:140840753-140840775 TCACACCAGCACAGCAGACCAGG + Intergenic
963050087 3:141134636-141134658 TTAAACCATCCCTGCATGCCTGG + Intronic
963113203 3:141703171-141703193 TTAAACCATCCCTGCATCCCTGG - Intergenic
963176404 3:142302329-142302351 TTAAACCATTCCTGCATCCCTGG - Intergenic
963213575 3:142720861-142720883 TTAAACCATCCCTGCATCCCTGG - Intergenic
963333246 3:143940108-143940130 TTAAACCATCGTTGCATCCCAGG - Intergenic
964146956 3:153475262-153475284 TTAAACCGTCCCTGCATCCCTGG + Intergenic
964160964 3:153644456-153644478 TTAAACCATTCCTGCATCCCTGG - Intergenic
964189938 3:153989856-153989878 TTAAACCATCCCTGCATCCCTGG - Intergenic
964300622 3:155281141-155281163 TTGAACCATCCCTGCATCCCTGG - Intergenic
964393926 3:156225241-156225263 TTAAACCATCCCTGCATCCCTGG - Intronic
964644151 3:158940264-158940286 TTAAACCATCCCTGCATCCCTGG - Intergenic
964882335 3:161437387-161437409 TTGAACCATCCCTGCATCCCAGG - Intergenic
964916010 3:161843016-161843038 TTAAACCATCCCTGCATCCCCGG + Intergenic
965052413 3:163667968-163667990 TTAAACCATCCCTGCACCCCTGG + Intergenic
965216552 3:165871483-165871505 TTAAAGCATCCCTGCATCCCTGG + Intergenic
965296328 3:166951878-166951900 TTAAGCCATCTCTGCATCCCTGG + Intergenic
965303637 3:167036472-167036494 TGAGACCATCACTTGAGCCCAGG - Intergenic
965345462 3:167543462-167543484 TTAAACCATCTCTGCATCCCTGG - Intronic
965992605 3:174838165-174838187 TTAAACCATCCCTGCATCCCTGG - Intronic
966093031 3:176163206-176163228 TTAAACCATCTCTGCATCCCTGG - Intergenic
966122692 3:176540252-176540274 TTAAAACATCCCTGCATCCCTGG - Intergenic
966153340 3:176890231-176890253 TTAAACCATCCCTGCATTCCTGG - Intergenic
966514191 3:180799187-180799209 TTAAACCATCCCTGCATCCCTGG - Intronic
967203607 3:187098687-187098709 TTAAACCATCCCTGCATCCTTGG - Intergenic
967209398 3:187153952-187153974 TTAAACCATCCCTGCATCCCTGG - Intronic
967227854 3:187310119-187310141 TTAAACCATCATTGCATCCCAGG + Intergenic
968125216 3:196154053-196154075 TTAAACCGTCCCTGCATCCCTGG + Intergenic
968721032 4:2204762-2204784 TTAGACCAACCCTGCATCCCTGG - Intronic
969247933 4:5947686-5947708 TTTCACCCCCACTGGAGCCCTGG + Intronic
969639621 4:8389050-8389072 TCCCACCACCACTGCTGCCCCGG + Intronic
970605120 4:17672697-17672719 TTAAACCATCCCTGCACCCCTGG + Intronic
970605519 4:17677843-17677865 TTAAACCATCCCCGCATCCCTGG - Intronic
970658317 4:18256871-18256893 TTAAACCATCCCTGAATCCCTGG + Intergenic
970874374 4:20852298-20852320 TTAAACCATCCCTGCATTCCTGG - Intronic
971182800 4:24346099-24346121 TTAAACCATCCCTGCGTCCCTGG + Intergenic
971509012 4:27400612-27400634 TTAAACCATCCCTGCATCCCTGG - Intergenic
972049119 4:34705961-34705983 TTAAACTATCCCTGCATCCCTGG - Intergenic
972270391 4:37505234-37505256 TTAAACCATCCTTGCATCCCTGG + Intronic
972384967 4:38556704-38556726 TTAAACCATCCCTGCATCCCTGG + Intergenic
972806774 4:42536765-42536787 TTAAACCATCTCTGCATCCCTGG - Intronic
972827083 4:42771434-42771456 TTAAACCATCCCTGCATCTCTGG - Intergenic
973044141 4:45513951-45513973 TTAAACCATCCCTGCATCCCTGG + Intergenic
973244205 4:47993010-47993032 TTAAACCATCCCTACATCCCTGG + Intronic
973675735 4:53260547-53260569 TTAAACCATCCCTCCATCCCTGG + Intronic
973777223 4:54254787-54254809 TAACACCAGCCCTGCATCCCAGG + Intronic
973782758 4:54304496-54304518 TTAAACCATCCCTGCATCCCTGG - Intergenic
973831199 4:54761175-54761197 TTAAATCATCCCTGCATCCCTGG + Intergenic
973925973 4:55737740-55737762 TCAAACCATCCCTGCATCCCTGG - Intergenic
974009022 4:56590323-56590345 TTAAACCATTCCTGCATCCCTGG + Intronic
974127412 4:57713521-57713543 TTAAATCATCTCTGCATCCCTGG - Intergenic
974133162 4:57781514-57781536 TTAAACCATCCCTGCATCCCTGG + Intergenic
974209460 4:58750558-58750580 TTAGAGGATCACTGGAGCCCAGG + Intergenic
974281437 4:59799827-59799849 TTAAACCATCCCTGCATCACTGG + Intergenic
974327628 4:60435374-60435396 TTAAACCATTCCTGCATCCCTGG + Intergenic
974458011 4:62153307-62153329 TTAAACCATCCCTGCATCCCTGG - Intergenic
974677699 4:65115776-65115798 TTAAACCATCTTTGCATCCCTGG - Intergenic
974801520 4:66824791-66824813 TTAAACCATCCCTGCATCCCTGG + Intergenic
974849163 4:67384931-67384953 TTAAACCATCCCTGCATCCCTGG - Intergenic
974951231 4:68584952-68584974 TTAAACCATCCCTGCATCCCTGG - Intronic
975185116 4:71392836-71392858 TTAAACCATCCCTGCATCCCTGG - Intronic
975204422 4:71628016-71628038 TTAAACCATCCCTGCATTCCTGG - Intergenic
975335864 4:73174255-73174277 TTAAACCATCTCTGCATTCCTGG - Intronic
975364611 4:73514795-73514817 TTAAACCACCCCTGCATCCCTGG + Intergenic
975510087 4:75184722-75184744 TTGAACCATCCCTGCATCCCTGG - Intergenic
975623629 4:76319613-76319635 TTAAACCATCCCTGCATCCCTGG - Intronic
975928486 4:79489415-79489437 TTAAACCATCCCTGCATCCCTGG + Intergenic
976157480 4:82162351-82162373 TTAAACCATTTCTGCATCCCTGG - Intergenic
976363764 4:84210273-84210295 TTAAACCATCCCTGTATCCCTGG - Intergenic
976423377 4:84871677-84871699 TTGCACCTGCACTCCAGCCCTGG - Intronic
976455374 4:85240688-85240710 TTAAACCATCCCTGCATCCCTGG + Intergenic
976556514 4:86456979-86457001 TTAAACCATCCCTGCATCCCTGG - Intronic
976666390 4:87597772-87597794 TTAAATCATCCCTGCATCCCTGG + Intergenic
976791552 4:88884322-88884344 TTAAGCCATCTCTGCATCCCTGG - Intronic
976888167 4:90011191-90011213 TTAAACCATCCCTGCATCCCTGG - Intergenic
977481622 4:97585193-97585215 TTAAACCATCCCTGCATCCCTGG - Intronic
977510808 4:97960019-97960041 TTAAACCTTCCCTGCATCCCTGG - Intronic
977513615 4:97993396-97993418 TCAAACCATCCCTGCATCCCTGG + Intronic
977549637 4:98427041-98427063 TTAAACCATCCCTGCATCCCTGG - Intronic
977803313 4:101265159-101265181 TTGCACCACTACTGCAGCCTGGG - Intronic
977813569 4:101387009-101387031 TTAAACCATCCCTGCATCCGTGG + Intergenic
977826397 4:101537162-101537184 TTGAACCATCCCTGCATCCCTGG - Intronic
977904383 4:102458680-102458702 TTAAACCATCCCTGCATCCCTGG - Intergenic
978027909 4:103900473-103900495 TTAAACCATCCCTGCATCCCTGG - Intergenic
978158193 4:105513587-105513609 TTAAACAATCCCTGCATCCCTGG + Intergenic
978185311 4:105850332-105850354 TTACACAATAAATGCAGACCTGG + Intronic
978201337 4:106026964-106026986 TTAAACCATCTCTGCATCCCTGG + Intergenic
978264630 4:106808834-106808856 TTAAACCATCCTTGCATCCCAGG - Intergenic
978537873 4:109781831-109781853 TTAAACCACCCCTGCATCCCTGG - Intronic
978757585 4:112320363-112320385 TTAAACTATCCCTGCATCCCTGG + Intronic
978762145 4:112364878-112364900 TTAAACCATCCCTGCATCCCTGG - Intronic
978916431 4:114131173-114131195 TTAAACCATCCCTGCCTCCCTGG - Intergenic
978999124 4:115196059-115196081 TTAAACCATCCCTGCATCCCTGG + Intergenic
979046254 4:115869426-115869448 TTAAACCATCTTTGCATCCCTGG + Intergenic
979381775 4:120015009-120015031 TTAAACCATCCCTGCATCCCTGG + Intergenic
979498126 4:121407993-121408015 TTAAACCATCCCTGCATCCCTGG + Intergenic
979570420 4:122217068-122217090 ATAAACCATCCCTGCATCCCTGG + Intronic
979638532 4:122984769-122984791 TTAAACCATCCCTGCATCCCTGG + Intronic
979705257 4:123713189-123713211 TTAAACCATCCCTGCATCCCTGG - Intergenic
979706941 4:123731556-123731578 TTAAACCATCCTTGCATCCCAGG + Intergenic
979712387 4:123794977-123794999 TTAAACCATCCCTGCATCCCTGG + Intergenic
979794618 4:124831389-124831411 TTAAACCATCCCTGCATCCCTGG + Intergenic
979995742 4:127428649-127428671 TTAAATCATCCCTGCATCCCTGG - Intergenic
980019693 4:127693890-127693912 TTAAACCATCCCTGCATTCCTGG + Intronic
980087440 4:128405916-128405938 TTAAACTATCCCTGCATCCCTGG + Intergenic
980238161 4:130135349-130135371 TTAAACCATCCCTGTATCCCTGG - Intergenic
980543779 4:134230441-134230463 TTAAACCATCCCTGCACCCCTGG + Intergenic
980580142 4:134739828-134739850 TTAAACCATCCCTGCATCCCTGG - Intergenic
980580363 4:134742521-134742543 TTAAACCATCCCTGTATCCCTGG - Intergenic
980926823 4:139145712-139145734 TTAAACCATCCCTGCATTCCTGG - Intronic
981177406 4:141698156-141698178 TTAAACCATCCCTGCAACTCTGG + Intronic
981361690 4:143853166-143853188 TTAGACCATCCCTGCATCCCTGG + Intergenic
981461710 4:145020256-145020278 TTAAACCATCCCTGCATCCCTGG - Intronic
981559728 4:146033566-146033588 TTAAACCATCCCTGCATCCCTGG - Intergenic
981626298 4:146759607-146759629 TTAAACCATCCCTGCATCCTTGG - Intronic
981680645 4:147393780-147393802 GTAAACCATCTCTGCATCCCTGG + Intergenic
981886951 4:149687771-149687793 TTAAACCATCCCTGCATCCCTGG - Intergenic
981889916 4:149723606-149723628 TTGAACCATCCCTGCACCCCTGG + Intergenic
982119287 4:152125643-152125665 TTAAACCATCCCTGCATCCCTGG + Intergenic
982299202 4:153861674-153861696 TTAAACCATCCCTGCATCCCTGG + Intergenic
982451368 4:155556101-155556123 TTAAACAATCCCTGCATCCCTGG - Intergenic
982531673 4:156552632-156552654 TTAAACCATCTCTGTATCCCTGG + Intergenic
982804157 4:159742523-159742545 TTAAACCATCCCTGCATCCCTGG + Intergenic
982903504 4:161038623-161038645 TTAAACCATCCTTGCATCCCTGG - Intergenic
983072445 4:163284875-163284897 TTAAAGCATCCCTGCATCCCTGG + Intergenic
983277801 4:165639386-165639408 TTAAACCGTCCCTGCATCCCTGG - Intergenic
983337344 4:166414559-166414581 TTGAACCATCATTGCATCCCTGG + Intergenic
983347293 4:166543147-166543169 TTAACCCATCCCTGCATCCCTGG - Intergenic
983687545 4:170429314-170429336 TTCCACCAGCACAGCAGCTCAGG - Intergenic
983754952 4:171323592-171323614 TTAAACCATCCCTGCATCTCTGG - Intergenic
983825978 4:172260922-172260944 TTAAGCCATCCCTGCATCCCTGG + Intronic
983962764 4:173774589-173774611 TTAAATCATCCCTGCATCCCTGG + Intergenic
984066832 4:175058488-175058510 TTAAACCATCCCTGCATCCCTGG - Intergenic
984328393 4:178283336-178283358 TCACTCCAGCACTCCAGCCCGGG - Intergenic
984474767 4:180222219-180222241 TTAAACCATCCCTGCATCCCTGG + Intergenic
984951479 4:185010994-185011016 TGACATCATGACTTCAGCCCAGG + Intergenic
985107953 4:186517102-186517124 TTAAGCCATCCCTGCATCCCTGG + Intronic
985284359 4:188319929-188319951 TTAAACCACCCCTGCATCCCTGG - Intergenic
985326105 4:188772488-188772510 TTAAACCATCCCTGCATCCCTGG + Intergenic
986259312 5:6129627-6129649 TTAAACCATCCATGCATCCCTGG - Intergenic
986340169 5:6782216-6782238 TTACACCAACACAGGAGTCCTGG + Intergenic
986463950 5:8002204-8002226 TTGCACCATCCTTGCATCCCTGG + Intergenic
986630833 5:9771336-9771358 TTAAACCATCCTTGCATCCCTGG + Intergenic
986870544 5:12040148-12040170 TTAAACTATCCCTGCATCCCTGG - Intergenic
987006131 5:13711189-13711211 TTAAACCATCCCTGCATCCCTGG - Intronic
987030112 5:13968633-13968655 TTAAACCATCCCTGAATCCCTGG + Intergenic
987106313 5:14643252-14643274 TTGAACCATCCCTGCATCCCTGG + Intergenic
987176489 5:15315926-15315948 TTAAACCATCTCTGCATCCCTGG - Intergenic
987185459 5:15412758-15412780 TTAAACCATCCCTGCATCCCTGG - Intergenic
987414152 5:17645595-17645617 TTAAACCATCTCTGCATCCCTGG + Intergenic
987436607 5:17902748-17902770 TTAAACCATCCCTGCATCCCTGG + Intergenic
988173773 5:27693804-27693826 TTAAACGATCCCTGCATCCCTGG - Intergenic
988504658 5:31811378-31811400 TTACACCATCACTGCAGCCCTGG - Intronic
988902550 5:35749005-35749027 TTAAACCATCCCTGCATCCCTGG - Intronic
988929404 5:36021722-36021744 TTAAACCATCCCTGCATCCCTGG + Intergenic
989006841 5:36824333-36824355 TTAAACCATCCCTGCATCCCTGG + Intergenic
989028786 5:37095255-37095277 TTAAACCACCTCTGCATCCCTGG - Intergenic
989211070 5:38860386-38860408 TTGAACCATCCCTGCATCCCGGG + Intronic
989817945 5:45759434-45759456 TTAAATCATCTCTGCATCCCTGG + Intergenic
990005683 5:50941741-50941763 TTAAATCATCTCTGCATCCCCGG - Intergenic
990233658 5:53742682-53742704 TTAAACCATCCCTGTATCCCTGG - Intergenic
990281562 5:54256763-54256785 TTAAACCATCCCTGCATCCCTGG - Intronic
990602419 5:57372965-57372987 TTAAACTATCCCTGCATCCCTGG - Intergenic
990632563 5:57686635-57686657 TTATGCCATCACTCCAGCCTAGG - Intergenic
990672925 5:58152676-58152698 TTAAACCATCCCTGCATCCCTGG - Intergenic
990775820 5:59304715-59304737 TTAAACCATCTCTGCACCCCTGG + Intronic
990918395 5:60935857-60935879 TTAAACCATCCCTGCATTCCTGG + Intronic
991288003 5:65001637-65001659 TTGAACCATAACTGCATCCCTGG + Intronic
992335735 5:75767148-75767170 TTAAACCATCCCTGCATTCCTGG + Intergenic
992339770 5:75811152-75811174 TTAAACCATCCCTGCATCCCTGG + Intergenic
992403818 5:76437001-76437023 TTAAACCATCCCTGCATTCCTGG + Intronic
992898996 5:81274041-81274063 TTAAACCATCCCTGCATCCTTGG - Intergenic
993022581 5:82609448-82609470 TTAAACCATCCTTGCATCCCTGG - Intergenic
993401698 5:87461144-87461166 TTAAACCATCCCTGAATCCCTGG - Intergenic
993448153 5:88040109-88040131 TTAAACCATCCCTCCATCCCTGG + Intergenic
993562101 5:89422723-89422745 TTAAACCATCCCTGCATCCCCGG + Intergenic
993694538 5:91045360-91045382 TTAAACCATCCCTGCATGCCTGG - Intronic
993743580 5:91568342-91568364 TTAAACCATCCCTGCATCCCTGG - Intergenic
993754882 5:91716410-91716432 TTAAACCATCCCTGCATCCCTGG + Intergenic
993796941 5:92279245-92279267 TTAAACCATTCCTGCATCCCTGG - Intergenic
993883568 5:93391425-93391447 TTAAACCATCCCTGCATCCCTGG + Intergenic
993917379 5:93759568-93759590 TTAAACCATCCCTGCATTCCTGG - Intronic
993954933 5:94220902-94220924 TTTAACCATCACAGCAGACCTGG + Intronic
993965102 5:94350602-94350624 TTAAACCATCCCTGCATCCCTGG - Intronic
994496907 5:100524043-100524065 TTAAACCATCCCTGTATCCCTGG - Intergenic
994925074 5:106105178-106105200 TTAAACGATCCCTGCATCCCTGG - Intergenic
994948269 5:106423928-106423950 TTGAACCATTCCTGCAGCCCTGG + Intergenic
995115757 5:108476855-108476877 TTGAACCATCCCTGCATCCCTGG - Intergenic
995161456 5:108988110-108988132 TTGAACCATCCCTGCATCCCTGG + Intronic
995293437 5:110487627-110487649 TTAAACCATCCCTGCATCCCTGG + Intronic
995347733 5:111139862-111139884 TTAAACCATCCCTGCATCCCTGG - Intergenic
995351361 5:111179627-111179649 TTAAACCATCCCTGCATCCTGGG + Intergenic
995375190 5:111466021-111466043 TTAAACCATCCCTGCATCCCTGG - Intronic
995450832 5:112298504-112298526 TTAAACCATCCCTGCATTCCTGG + Intronic
995509094 5:112890240-112890262 TGATACCATCACTGCAATCCAGG + Intronic
995674750 5:114651095-114651117 TTAGACCAACATTGCAGGCCTGG + Intergenic
995693554 5:114854695-114854717 TTAAACCATCCCTGTATCCCTGG - Intergenic
995699721 5:114921017-114921039 TTAAAGCATCCCTGCATCCCTGG - Intergenic
995722948 5:115155486-115155508 TTAAACCATCCCTGCATCCCTGG - Intronic
996011076 5:118482507-118482529 TTAAGCCATCCCTGCATCCCTGG - Intergenic
996025530 5:118641253-118641275 TTAAACCATCCCTGCCTCCCTGG - Intergenic
996032278 5:118719036-118719058 TAAAACCATCCCTGCATCCCTGG - Intergenic
996110458 5:119560187-119560209 TTAAACCACCCCTGCATCCCTGG - Intronic
996198140 5:120635439-120635461 TTAAACCATCCCTGCATCCCTGG - Intronic
996325733 5:122270876-122270898 TTAAACCATGCCTGCATCCCTGG - Intergenic
996495006 5:124145241-124145263 TTAAACCATCACTGCATCCCTGG + Intergenic
996608721 5:125354136-125354158 TTAAACCATCCCTGCATCCCTGG + Intergenic
996616173 5:125443713-125443735 TTAAACCATCCCTGCATCCCTGG - Intergenic
996655786 5:125934292-125934314 TTAAACCATCCCTGCATTCCTGG - Intergenic
996678657 5:126205884-126205906 TTAAACCATCCCTGCATCCCTGG - Intergenic
996694693 5:126381219-126381241 TTAAACCATCCCTGCATCCCTGG + Intronic
996875089 5:128231921-128231943 TTAAACCATCCCTGCATCCCTGG + Intergenic
997003787 5:129794573-129794595 TTACACCATCCCTGCATCTCTGG + Intergenic
997387707 5:133486710-133486732 TGAGACCATCACTTCAGACCAGG - Intronic
998391397 5:141789106-141789128 TTTCTCCATCTCTGCAGCCCAGG + Intergenic
998523049 5:142817764-142817786 CTCCACCATCACTGCAGCAGGGG - Intronic
998603451 5:143608568-143608590 TTAAACCATCCCTGCATCCCTGG - Intergenic
998746366 5:145264314-145264336 TTAAACCATCCCTACATCCCTGG - Intergenic
999337827 5:150738437-150738459 TCAAACCATCCCTGCATCCCTGG - Intronic
999445240 5:151633596-151633618 CTACACCAAAACTGCAGCTCAGG + Intergenic
999484370 5:151980486-151980508 TTAAACCATCCCTGCATCCCTGG + Intergenic
999800962 5:155035692-155035714 TTAAACCATCCCTGCATCTCTGG + Intergenic
999822685 5:155244066-155244088 TTAAACCATCCCTGCATTCCTGG + Intergenic
1000215458 5:159151502-159151524 TTAAACCATCCCTGCATCCCTGG + Intergenic
1000704404 5:164492630-164492652 TTAAACCAGCCCTGCATCCCAGG + Intergenic
1000780076 5:165469175-165469197 TTAAACCATCCCTGCATCCCTGG - Intergenic
1000943158 5:167387837-167387859 TTAAACCATCTCTGAATCCCTGG + Intronic
1001167038 5:169378562-169378584 TTAAACCATCCCTGCGTCCCTGG - Intergenic
1001291026 5:170460511-170460533 TTAAACCCTCCCTGCATCCCTGG - Intronic
1001733405 5:173977826-173977848 TTAAACTATCCCTGCATCCCTGG + Intronic
1001767767 5:174266278-174266300 TTAAACCATCCCTGCATCCCTGG - Intergenic
1002893179 6:1355604-1355626 TTAAACCATACCTGCATCCCTGG - Intergenic
1003029101 6:2585886-2585908 TTAAACCATCCCTGCATCCCTGG + Intergenic
1003353745 6:5345381-5345403 TTTCACAATCTCTGCAGTCCTGG - Intronic
1003465264 6:6373920-6373942 TTAAACCATCTCTGCATCCCTGG - Intergenic
1003930047 6:10915640-10915662 TTAAACCATTCCTGCATCCCTGG + Intronic
1003954334 6:11147980-11148002 TTGCACCATCGCTGCAGTGCAGG - Intergenic
1004096870 6:12564369-12564391 TTAAACCATCCCTGCATCCCTGG - Intergenic
1004593119 6:17073030-17073052 TTAAACCTTCCCTGCATCCCTGG + Intergenic
1004711639 6:18176774-18176796 TTAAACCATCCCTACATCCCTGG + Intronic
1004777870 6:18868956-18868978 TTAAACCATCCCTGCATTCCTGG - Intergenic
1004888856 6:20078255-20078277 TTAAACCATCCCTGCATCCCTGG - Intergenic
1005244446 6:23865786-23865808 TTAAACCATGCCTGCATCCCTGG - Intergenic
1005259167 6:24039168-24039190 TTAAACCATCCCTGCATCCCTGG + Intergenic
1005504877 6:26460865-26460887 TTACCACATCACTCCAGCCTGGG + Intronic
1005691228 6:28308078-28308100 TTAAACCATCCCTGCATCCCTGG + Intergenic
1005919387 6:30385984-30386006 TTAAACCATCTCTGCATCCCTGG - Intergenic
1006062679 6:31436084-31436106 TTAAACCATCCCTGCATCCCTGG + Intergenic
1006280052 6:33044821-33044843 TTAAACCATCCCTGCATCCCTGG + Intergenic
1006978929 6:38130631-38130653 TTAAACCATCCCTGCATCCTTGG + Intronic
1006989480 6:38201265-38201287 TTAAACCATCCTTGCATCCCTGG - Intronic
1007131623 6:39480371-39480393 TTAAACCATCCTTGCATCCCTGG + Intronic
1007499044 6:42281275-42281297 TCACACTCTCCCTGCAGCCCAGG - Intronic
1007815264 6:44518952-44518974 TTGCACCATCCTTGCATCCCTGG + Intergenic
1007891220 6:45294157-45294179 TTAAACCATCCCTGTATCCCTGG - Intronic
1007893033 6:45313964-45313986 TTAAACCATCCCTGCATCCCTGG - Intronic
1008041974 6:46811790-46811812 TGAAACCATCCCTGCATCCCTGG + Intronic
1008121378 6:47621362-47621384 TTAAACCATCCCTGCATCCCTGG + Intronic
1008140116 6:47822258-47822280 TTACCCTCTCTCTGCAGCCCAGG - Intronic
1008190531 6:48451325-48451347 TTAAACCATCCCTGCATCCCTGG - Intergenic
1008305629 6:49895724-49895746 TTAAACCATCCCTGCATTCCAGG - Intergenic
1008528307 6:52430527-52430549 TTAAATCATCCCTGCATCCCTGG + Intronic
1008707113 6:54176047-54176069 TTAAACCATCATTGCATCCCTGG + Intronic
1008775091 6:55028687-55028709 TTAAACCATCCCTGCGTCCCTGG + Intergenic
1008976089 6:57429017-57429039 TTATACCATCTCTGCAGCCTTGG + Intronic
1009164619 6:60326159-60326181 TTATACCATCTCTGCAACCTTGG + Intergenic
1009332212 6:62437878-62437900 CTAAACCATCTCTGCATCCCTGG + Intergenic
1009495207 6:64337801-64337823 TTAAACCACCCCTGCATCCCTGG - Intronic
1009589382 6:65646346-65646368 TTAAACCATCCCTGCATCCCTGG - Intronic
1009867356 6:69413937-69413959 TTAAACCATCCCTGCATCCCTGG - Intergenic
1009969340 6:70610004-70610026 TTAAACCATTCCTGCATCCCTGG - Intergenic
1010008677 6:71025529-71025551 TTAAACCATCCCTGCATCCCTGG + Intergenic
1010027983 6:71241615-71241637 TTAAATCATCCCTGCATCCCTGG - Intergenic
1010045620 6:71439712-71439734 TTAAACCATCCCTGCATCCCTGG - Intergenic
1010076047 6:71800015-71800037 TTAAACCATCCCTGCATCCCTGG + Intergenic
1010164780 6:72902660-72902682 TTAAACTATCCCTGCATCCCTGG + Intronic
1010181581 6:73092730-73092752 TTAAACTATCCCTGCATCCCTGG + Intronic
1010479565 6:76334695-76334717 TTAAACCATCCCTGCATCCCTGG + Intergenic
1010707406 6:79131478-79131500 TTAAACCATCCCTGCATCCCTGG + Intergenic
1010858099 6:80868830-80868852 TTAAACCATCCCTGCATCCTGGG + Intergenic
1010862759 6:80934092-80934114 TTAAACCATCCCTGCATCCCTGG + Intergenic
1010971198 6:82265011-82265033 TTACCCCATCACAGCCTCCCTGG + Intergenic
1010976235 6:82317064-82317086 TTAAACCATCCCTGCATCCCTGG - Intergenic
1011005551 6:82640919-82640941 TTAAACCATCCCTGCATCCCTGG - Intergenic
1011093184 6:83630170-83630192 TTAAACCTTCCCTGCATCCCTGG + Intronic
1011132811 6:84069412-84069434 TTAAACCATCCCTGCATCCCTGG + Intronic
1011320909 6:86092045-86092067 TTAAACCATCCCTGCATTCCTGG + Intergenic
1011327464 6:86165259-86165281 TTAAACCATCCCTGCATTCCTGG - Intergenic
1011789405 6:90882126-90882148 TTAAATCATCCCTGCATCCCTGG + Intergenic
1011817268 6:91207303-91207325 TTAAATCATCCCTGCATCCCTGG + Intergenic
1011892986 6:92190705-92190727 TTAAACCACCCCTGCATCCCTGG + Intergenic
1011947609 6:92926029-92926051 TTAAACCATCCCTGCATCCCTGG + Intergenic
1012158606 6:95853811-95853833 TTGAACCATCCTTGCAGCCCAGG + Intergenic
1012183400 6:96183762-96183784 TTAAACCATCCCTGCATCCCTGG + Intronic
1012357218 6:98329752-98329774 TTAAACCATCCCTGCATCCCTGG + Intergenic
1012738138 6:102977172-102977194 TTAAACCATCTGTGCATCCCTGG - Intergenic
1012794118 6:103738068-103738090 TTAAACCATCCCTGCATCCCTGG - Intergenic
1012923056 6:105239396-105239418 TTAAACCATCCCTGCATCCCTGG - Intergenic
1013241848 6:108253828-108253850 TTAAACCACCACTGCCGGCCGGG + Intronic
1013368638 6:109452752-109452774 TTACACCTTCACAGCAGCTATGG + Intronic
1013686157 6:112585895-112585917 TTAAACCATCCCTGCATCACTGG + Intergenic
1013850672 6:114510730-114510752 TTAAACCATCCCTGCATCCCTGG - Intergenic
1013900691 6:115152830-115152852 TTAAACCATCCCTGCATCCCTGG + Intergenic
1013946135 6:115724894-115724916 TTAAACCATCTCTGCATCCCTGG + Intergenic
1014055791 6:117014333-117014355 TTAAACCATCCCTGCATCCCTGG - Intergenic
1014186543 6:118441065-118441087 TTGAACCATCCCTGCATCCCTGG + Intergenic
1014235438 6:118948756-118948778 TTAAAACATCCCTGCATCCCTGG - Intergenic
1014274478 6:119371360-119371382 TTACCCCACCTCTCCAGCCCTGG - Intergenic
1014304531 6:119724123-119724145 TTAAACCATCCCTGCATCCCTGG + Intergenic
1014481745 6:121947605-121947627 TTAAACCATCCCTGCATCCCTGG + Intergenic
1014531079 6:122560363-122560385 CTAAACCATCCCTGCATCCCTGG + Intronic
1014604218 6:123451919-123451941 TTAAACCATCCCTTCATCCCTGG - Intronic
1014658529 6:124136678-124136700 TTAAACCGTCCCTGCATCCCTGG - Intronic
1014792484 6:125689951-125689973 TTAAACCATCCCTGCATCCCTGG + Intergenic
1014973366 6:127846959-127846981 TTAAACTATCTCTGCATCCCTGG - Intronic
1015081564 6:129232345-129232367 TAACAACAGGACTGCAGCCCTGG - Intronic
1015222473 6:130820079-130820101 TTAAACCAGCCCTGCATCCCTGG - Intergenic
1015348162 6:132183925-132183947 TTAAACCATCCCTGAATCCCTGG - Intergenic
1015368235 6:132421870-132421892 TTAAACCATCCTTGCATCCCAGG + Intergenic
1015565894 6:134570690-134570712 TTAAACCATCCCTGCATCCCTGG - Intergenic
1015837855 6:137440935-137440957 TTAAACCATCCTTGCATCCCTGG + Intergenic
1015877654 6:137839648-137839670 TTAAACCATCCCTGCATCCTTGG + Intergenic
1016059787 6:139618258-139618280 TTAAACCATCCCTGCATCCCTGG + Intergenic
1016127560 6:140424233-140424255 TTGAACCATCCCTGCATCCCAGG + Intergenic
1016351344 6:143172385-143172407 TTAAACCATCCCTTCATCCCTGG + Intronic
1016365843 6:143317327-143317349 TTAAACCATCCCTGCATCTCTGG - Intronic
1016496765 6:144671977-144671999 TTAAACCATCCCTGCATCCCTGG + Intronic
1016643174 6:146374186-146374208 TTGAACCATCCCTGCATCCCAGG + Intronic
1016650897 6:146458792-146458814 TTAAACCATCCTTGCATCCCTGG + Intergenic
1016909817 6:149187131-149187153 TTAAACCATCCCTGCATCCCTGG + Intergenic
1017190169 6:151645017-151645039 TTAAACCATCCCTGCATCCCTGG + Intergenic
1017214584 6:151895711-151895733 TTAAACCATCCCTGCATCCCTGG + Intronic
1017221649 6:151972474-151972496 TTAAACCATCCCTGCATCCCTGG - Intronic
1017242937 6:152191090-152191112 TTCAACCATCATTGCATCCCTGG + Intronic
1017534950 6:155337388-155337410 TTAAACCATCCCTGCATCCCTGG + Intergenic
1017556015 6:155569622-155569644 TTAAACCATCCCTGCATCCTTGG + Intergenic
1018009730 6:159659124-159659146 TTAAACCATCCCTGCATCCCTGG - Intergenic
1018417073 6:163611105-163611127 TTGCACCAGCACTCCAGCCTGGG - Intergenic
1018656144 6:166038329-166038351 TTAAACCATCCCTGCTTCCCTGG + Intergenic
1018665992 6:166138768-166138790 TTAAACCATCCCTGCATCCCTGG - Intergenic
1018755585 6:166846531-166846553 TTAAACCATCCCTGCATTCCTGG - Intronic
1018781484 6:167070804-167070826 TTAAACCATCTCTGCACTCCTGG + Intergenic
1019044783 6:169136330-169136352 TTAAACCATCCTTGCATCCCTGG - Intergenic
1019637047 7:2081563-2081585 TCCCTGCATCACTGCAGCCCAGG + Intronic
1020203158 7:6095808-6095830 TGACCACACCACTGCAGCCCGGG - Intergenic
1020332079 7:7029112-7029134 TTAAACCATCCCTGCATCCCTGG + Intergenic
1020348740 7:7194491-7194513 TTAAACCATCCCTGCACGCCTGG + Intronic
1020455552 7:8370156-8370178 TTAAACTATCCCTGCATCCCTGG + Intergenic
1020608866 7:10370582-10370604 TTAAACCATCCCTGCATCCCTGG - Intergenic
1020861111 7:13492922-13492944 TTAAACCATCCCTGCATCCCTGG - Intergenic
1020866569 7:13571473-13571495 TTAAAACATCCCTGCATCCCTGG + Intergenic
1021226626 7:18035807-18035829 TTAAACCATCCCTGCATCCCTGG + Intergenic
1021323210 7:19237136-19237158 TTAAACCATCCTTGCATCCCTGG + Intergenic
1021473775 7:21037021-21037043 TTAAACCATTCCTGCATCCCTGG + Intergenic
1022295667 7:29049839-29049861 TTAAACCATCCCTGCATCCCTGG - Intronic
1022564864 7:31388662-31388684 TTAAACCATCCCTGCATCCCTGG + Intergenic
1022759385 7:33331091-33331113 TTAAATCATCCCTGCATCCCTGG - Intronic
1022762615 7:33372470-33372492 TTAAACCATCCTTGCATCCCTGG + Intronic
1023144728 7:37138896-37138918 TTAAACCATCCCAGCATCCCTGG - Intronic
1023418774 7:39956630-39956652 TCACATCATCACTGCACTCCAGG - Intronic
1023657332 7:42437502-42437524 TTAAACCATCCCTGCATCCCTGG + Intergenic
1023692836 7:42809537-42809559 TTAAACCATCCCTGCATCCCTGG - Intergenic
1024126686 7:46305400-46305422 TTAAACCGTAACTGCATCCCCGG + Intergenic
1024162006 7:46685873-46685895 TTGAACCATCCTTGCAGCCCAGG - Intronic
1024327699 7:48123851-48123873 TTAAACCATTCCTGCATCCCTGG + Intergenic
1024417344 7:49122076-49122098 TTAAACCATCCCTGCATCCCTGG - Intergenic
1024545822 7:50517242-50517264 TTAAACCATCCCTGCATCCCTGG - Intronic
1024745029 7:52396476-52396498 TTAAACCATCCCTGCATCCCTGG + Intergenic
1024833501 7:53489194-53489216 TTAAATCATCTCTGCATCCCTGG + Intergenic
1024875921 7:54023170-54023192 TTAAACCATCCCTGCATTCCTGG + Intergenic
1024898375 7:54287039-54287061 TCAAACCATCCCTGCATCCCAGG - Intergenic
1024916904 7:54511875-54511897 TTAAACCATCCCTACATCCCTGG + Intergenic
1024917787 7:54523328-54523350 TTAAACCATCCCTGCATCCCTGG + Intergenic
1024946795 7:54816319-54816341 TTAAACCATCCGTGCATCCCTGG + Intergenic
1025773220 7:64532846-64532868 TTAAACCATCTCTGCATCCCTGG - Intronic
1025857600 7:65296589-65296611 TTAAACCATTCCTGCATCCCTGG + Intergenic
1026593701 7:71716765-71716787 TAACTCACTCACTGCAGCCCTGG - Intergenic
1027289335 7:76686251-76686273 TTTCACAATCAAAGCAGCCCTGG + Intergenic
1027328657 7:77068019-77068041 TTAAACCATCCCTCCATCCCTGG + Intergenic
1027732945 7:81899151-81899173 TTAAACCATCCCTGCATCCCTGG + Intergenic
1027838304 7:83275015-83275037 TTAAACCATCCCTGCCTCCCTGG + Intergenic
1028028540 7:85878214-85878236 TTAAACTATCTCTGCATCCCTGG - Intergenic
1028182710 7:87745136-87745158 TTAAAGCATCCCTGCATCCCTGG + Intronic
1028198101 7:87930575-87930597 TTAAACCATCCCTGCATCTCTGG - Intergenic
1028261978 7:88677633-88677655 TTAAACCATCCCTGCATCCCTGG - Intergenic
1028281344 7:88933117-88933139 TTAAGCCATCCCTGCATCCCTGG - Intronic
1028870142 7:95762121-95762143 TTGAACCATCCCTGCATCCCTGG - Intergenic
1028961904 7:96758470-96758492 TTAAACCATCCCTGCATCCCTGG + Intergenic
1028993100 7:97071477-97071499 TTAAACCATCCCTGCATCCCTGG + Intergenic
1029093782 7:98069207-98069229 TGACAGCATCACTGCACTCCAGG + Intergenic
1029787109 7:102803353-102803375 TTAAACCATCCCTCCATCCCTGG - Intronic
1030390126 7:108917665-108917687 TTAAACCTTCCCTGCATCCCTGG + Intergenic
1030972624 7:116079001-116079023 TTAAACTATCCCTGCATCCCTGG - Intronic
1031066357 7:117109864-117109886 TTAAACCATCCCTGCATCCCTGG - Intronic
1031090153 7:117344980-117345002 TTAAACCATCCCTGCATCCCTGG + Intergenic
1031139197 7:117922684-117922706 TTAAACCATCCCTACATCCCTGG - Intergenic
1031148117 7:118019960-118019982 TTAAACCATCCCTGCATCCCTGG - Intergenic
1031261651 7:119528482-119528504 TTAAACTATCCCTGCATCCCTGG - Intergenic
1031625665 7:123990024-123990046 TTAAACCATCCCTGCATCCCTGG + Intergenic
1031655134 7:124345774-124345796 TTAAACCATCCCTGCATCCCTGG + Intergenic
1031671321 7:124550090-124550112 TTACACATTCTATGCAGCCCAGG + Intergenic
1031879538 7:127180670-127180692 TTAAACCATCCCTGCATCCCTGG - Intronic
1032289006 7:130569877-130569899 TTAAACCATCCCTGCATCACTGG - Intronic
1032290357 7:130584132-130584154 TTAAACCATCCCTGCATCCCTGG - Intronic
1032912005 7:136443200-136443222 TTAAACCATCCCTGCACCCCTGG - Intergenic
1032922319 7:136563614-136563636 TTAAACTATCCCTGCATCCCTGG + Intergenic
1033027132 7:137785795-137785817 TTAAACCATCCCTGCATCCCTGG - Intronic
1033367660 7:140683856-140683878 TTTCTCCATCCCTCCAGCCCAGG - Intronic
1033702024 7:143848366-143848388 TTAAACCATCCTTGCATCCCTGG - Intergenic
1033816394 7:145078939-145078961 TGAAACCATCCCTGCATCCCTGG + Intergenic
1034019895 7:147630645-147630667 TTAAATCATCCCTGCATCCCTGG - Intronic
1034229823 7:149514304-149514326 TTAAACCATCCCTGCATCCCTGG + Intergenic
1034247497 7:149658656-149658678 TTAAACCATCCCTGCATCCCTGG + Intergenic
1034376808 7:150652798-150652820 TTAAACCATCCCTGTACCCCTGG + Intergenic
1034901495 7:154910480-154910502 GTGCACCATCCCTGCAGCCCAGG + Intergenic
1034996029 7:155577793-155577815 CTCCATCCTCACTGCAGCCCGGG - Intergenic
1035343507 7:158181257-158181279 TTAAACCATCCCTGCATCCCTGG + Intronic
1035600939 8:896385-896407 TCACACCATCCCGGCAGCTCAGG - Intergenic
1036498348 8:9290940-9290962 TTAAACCATCCCTGCATCCTTGG + Intergenic
1036686234 8:10913614-10913636 AAACACGATCACTGCAGCTCAGG + Intronic
1037055100 8:14430367-14430389 TTAAACCATTACTGCATCCCTGG - Intronic
1037459424 8:19094316-19094338 TTACTTCATCGCTGTAGCCCGGG - Intergenic
1037560276 8:20067510-20067532 TTAAACCATCCCTGCACCTCTGG + Intergenic
1037713290 8:21373179-21373201 TTAAACCATCCCTGCATCTCTGG + Intergenic
1037798079 8:22013497-22013519 TTACCACAGCACTGCAGCCTGGG + Intergenic
1038237390 8:25772854-25772876 TTAAACCATACCTGCATCCCTGG - Intergenic
1039082975 8:33751972-33751994 TTAAACCATCCCTGCATCCCTGG + Intergenic
1039208143 8:35180110-35180132 TTGAACCATCCCTGCATCCCTGG - Intergenic
1039268693 8:35856428-35856450 TTAAACCATCCCTGCATCCCTGG - Intergenic
1039420826 8:37437666-37437688 TTAAACCATCCTTGCATCCCAGG + Intergenic
1039748184 8:40451648-40451670 TTAAACCATCCCTGCATTCCTGG + Intergenic
1039810198 8:41040655-41040677 TTAACCCATCCCTGCATCCCTGG + Intergenic
1040711433 8:50193990-50194012 TTAAACCATCCCTGCATCTCTGG + Intronic
1040809631 8:51437510-51437532 TTAAACCATCTGTGCATCCCTGG - Intronic
1040867718 8:52066914-52066936 TTAAACCATCCTTGCATCCCTGG + Intergenic
1040966951 8:53092418-53092440 TTAAACCATCCCTGCACCACTGG + Intergenic
1041150620 8:54929253-54929275 TTAAACCATCCCTGCATCCATGG - Intergenic
1041293347 8:56329522-56329544 TTAAACCATTGCTGCATCCCTGG + Intergenic
1041366206 8:57107910-57107932 TGACACCTTCACTGCAGCTTTGG - Intergenic
1041637443 8:60159894-60159916 TTAAACCATCCCTGCATCCCTGG - Intergenic
1041832319 8:62168349-62168371 TTAAACTATCCCTGCATCCCTGG - Intergenic
1041877653 8:62709041-62709063 TTAAACCATCCCTGCATCCCTGG + Intronic
1042122503 8:65503716-65503738 TTAAACCACCCCTGCATCCCTGG + Intergenic
1042160883 8:65893763-65893785 CTAAACCATCCCTGCATCCCTGG - Intergenic
1042188578 8:66162338-66162360 TTAAACCATCCCTGCATTCCTGG + Intronic
1042285059 8:67100383-67100405 TTATACCACCACTGCACCCAAGG - Intronic
1042419325 8:68566949-68566971 TTAAACCATCCCTGCATCCCTGG + Intronic
1042465372 8:69123777-69123799 TTAAACCATCCCTGCATCCCTGG + Intergenic
1042482586 8:69320988-69321010 TTAAACCATCTCTGCATCCCTGG - Intergenic
1042608279 8:70569119-70569141 TTAAACCATCCCTGCATCCCTGG - Intergenic
1042644620 8:70972782-70972804 TTAAACAATCCCTGCATCCCTGG + Intergenic
1042768133 8:72349287-72349309 TTAAACCATCCCTGCATCTCTGG + Intergenic
1042897143 8:73683286-73683308 TTAAACTATCCCTGCATCCCTGG - Intronic
1043041091 8:75262837-75262859 TTAAACCATCCCTGCATCCCTGG - Intergenic
1043047799 8:75349735-75349757 TTAAACCATCCCTGCATCCCTGG - Intergenic
1043121357 8:76329252-76329274 TTAAACCATCCCTGCATCTCTGG + Intergenic
1043545409 8:81309965-81309987 TTAAACCATCCCTGCATCCCTGG - Intergenic
1043568508 8:81574272-81574294 CTAAACCATCCCTGCATCCCTGG + Intergenic
1043816561 8:84809301-84809323 TTAAACCATCCCTGCATCCCTGG + Intronic
1043832379 8:85004968-85004990 TTAAACCATCCCTGCATCCATGG - Intergenic
1043869635 8:85417998-85418020 TTGAACCATCATTGCATCCCAGG + Intronic
1044292188 8:90485665-90485687 TTAAACCATCCCTGCATCCCTGG - Intergenic
1045095211 8:98790347-98790369 TTAAACCATCACTGCATCCCTGG - Intronic
1045121892 8:99046846-99046868 TTAAACCATCCCTGCATCTCTGG + Intronic
1045878232 8:107007812-107007834 TTAAACCATCCCTGCGTCCCTGG - Intergenic
1045881248 8:107043407-107043429 TTAAACAATCTCTGCATCCCTGG - Intergenic
1046011348 8:108552023-108552045 TTAAACCAACATTGCATCCCAGG - Intergenic
1046352157 8:113029447-113029469 TTAAACCATCCCTGCATCCCTGG - Intronic
1046498500 8:115044740-115044762 TTAAACGATCCCTGCATCCCTGG - Intergenic
1046660944 8:116947926-116947948 CCACACCATGACTGCAGCCAGGG + Intergenic
1046750218 8:117919228-117919250 TCACACCACCACTCCAGCCTGGG - Intronic
1047032681 8:120899759-120899781 TTAAACCATCCCTGCATCCCTGG - Intergenic
1047227028 8:122964461-122964483 TTAAACCAGCCCTGCATCCCTGG + Intronic
1047271527 8:123364597-123364619 TTAAACCATCCCTGCATCCCTGG - Intronic
1047332181 8:123900821-123900843 TTAAACCATCTCTGCATCCCTGG + Intronic
1047348592 8:124052006-124052028 TTCCACAATGACTGCAGCCTAGG + Intronic
1047370806 8:124254251-124254273 TTCCATCTTCACTCCAGCCCCGG - Intergenic
1047530801 8:125673173-125673195 TTAAACCATCCCTGCATCCCTGG + Intergenic
1047901524 8:129427678-129427700 TTAAACCATCCCTGCATCCCTGG + Intergenic
1048120121 8:131570948-131570970 TTAAACCATCCCTGCATCCCTGG + Intergenic
1048804988 8:138231877-138231899 TGTCACCATCACGGCATCCCTGG + Intronic
1048994723 8:139787351-139787373 TTTCATCCTCACTGCAGCCTTGG + Intronic
1049229270 8:141473641-141473663 TCACCACTTCACTGCAGCCCGGG - Intergenic
1049869389 8:144961875-144961897 TTAAACCATCCCTGCATCCCTGG + Intergenic
1049897765 9:126034-126056 TTAAACCATCCCTGCATCCCTGG + Intronic
1049967455 9:792273-792295 TGACATCAGCACCGCAGCCCTGG + Intergenic
1050076161 9:1866902-1866924 TTGAACCATCATTGCATCCCTGG - Intergenic
1050147698 9:2587032-2587054 TTAAACCATCCCTGCATCCCTGG - Intergenic
1050428865 9:5541035-5541057 TTAAACCATCCCTGCATCCCTGG - Intronic
1050503128 9:6319295-6319317 TTAAACCATCCCTTCATCCCTGG - Intergenic
1051601059 9:18874595-18874617 TTAAACCATGCCTGCATCCCTGG + Intronic
1051687352 9:19671873-19671895 TTAAACCATCCCTGCATCCCTGG + Intronic
1051733504 9:20173004-20173026 TTAAACCATCTCTGCAACCCTGG - Intergenic
1051820530 9:21161161-21161183 TTAAACCATCCCTGCATCCCCGG - Intergenic
1052006356 9:23354298-23354320 TTAAACCATCCCTGCATCACTGG + Intergenic
1052053104 9:23871571-23871593 TTAAACCAACCCTGCATCCCTGG - Intergenic
1052141390 9:24989658-24989680 TTAAACCATCTCTGCATCCCTGG - Intergenic
1052375050 9:27709905-27709927 TTAAACCATCCTTGCATCCCAGG + Intergenic
1052549963 9:29935561-29935583 TTAAACCATCCCTGCATCCCTGG + Intergenic
1052624595 9:30959010-30959032 TTAAACCATCCCTGAATCCCTGG + Intergenic
1052638391 9:31132146-31132168 TTAAACCATCCCTGCGTCCCTGG + Intergenic
1052715606 9:32112658-32112680 TCAGAGCATCACTGCAACCCTGG + Intergenic
1052731155 9:32287891-32287913 TTAAAGCATCCCTGCATCCCTGG + Intergenic
1052951130 9:34213022-34213044 TTAAACCATCCCTGCATCCCTGG - Intronic
1053044572 9:34904543-34904565 TTAAACCATCCCTGCATCCCTGG + Intergenic
1053107168 9:35420520-35420542 TTAGACCATCCCTGCATCCCTGG - Intergenic
1053212223 9:36240474-36240496 TTAAACCATCCCTGCATCCCTGG + Intronic
1053740857 9:41136330-41136352 TTAAACCATCCCTGCATCCCTGG + Intronic
1054443845 9:65292475-65292497 TTAAACCATCCCTGCATCCCTGG + Intergenic
1054486428 9:65729028-65729050 TTAAACCATCCCTGCATCCCTGG - Intronic
1054687494 9:68294969-68294991 TTAAACCATCCCTGCATCCCTGG - Intronic
1054844482 9:69778824-69778846 TTAAACCATCCCTGTATCCCTGG + Intergenic
1055075825 9:72214033-72214055 TAACTCCATCAGTGCAGCACAGG - Intronic
1055138209 9:72847736-72847758 CTAAACCATCCCTGCATCCCTGG - Intergenic
1055141097 9:72877747-72877769 TTAAACCATCCCTGCATCCCTGG - Intergenic
1055566178 9:77570397-77570419 TGCCCCCACCACTGCAGCCCAGG + Intronic
1055794851 9:79964809-79964831 TCACAGCATCACAGCAGCCTGGG - Intergenic
1055846836 9:80575436-80575458 TTAAACCATCCCTGCATCCTTGG - Intergenic
1055905490 9:81289078-81289100 TTAAACCATCCCTGCATCCCTGG + Intergenic
1055906716 9:81303018-81303040 TTAAACCATCCCTGCATCCCTGG - Intergenic
1055911152 9:81353675-81353697 TTCAACCATCCCTGCATCCCTGG + Intergenic
1056026972 9:82508432-82508454 TTAAACCAGCCCTGCATCCCTGG - Intergenic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1056312637 9:85356161-85356183 TTAAACCATCCCTGCATCTCTGG + Intergenic
1056328097 9:85498290-85498312 TTAAACCATCCTTGCATCCCAGG - Intergenic
1056456997 9:86769986-86770008 TTAAACCATCCCTGCATCCCTGG - Intergenic
1056671746 9:88635018-88635040 TTAAACCATCCCTGCATCTCTGG + Intergenic
1056696502 9:88859683-88859705 TTAAACCATTCCTGCATCCCTGG - Intergenic
1056743293 9:89278794-89278816 TTAGAACACCACTGCAGGCCGGG + Intergenic
1056948418 9:91021453-91021475 TTAAATCATCCCTGCATCCCTGG - Intergenic
1056992819 9:91426341-91426363 ATACATCATCACTTCGGCCCTGG - Intergenic
1057119061 9:92554535-92554557 TTAAACCATCCCTGCATCCCTGG + Intronic
1057429742 9:94982659-94982681 TTGCCCTTTCACTGCAGCCCGGG - Intronic
1058030268 9:100188499-100188521 TTAAAGCATCCCTGCAGCCCTGG + Intronic
1058084718 9:100736389-100736411 TTAAACCATCCCTGCATCCCTGG + Intergenic
1058156405 9:101521037-101521059 TTAAACCATCCCTGCATCCCTGG + Intronic
1058228110 9:102392043-102392065 TTAAACCATCCCTGCATCCTTGG + Intergenic
1058233908 9:102465183-102465205 TTAAACCATCCCTGCATCCCTGG - Intergenic
1058410787 9:104728773-104728795 TTAAACCATCCCCGCATCCCTGG - Intergenic
1058540331 9:106005617-106005639 TTAAACCATTGCTGCATCCCTGG + Intergenic
1058622871 9:106902239-106902261 TTAAACCATCCCTGCATCCCTGG + Intronic
1058631266 9:106989357-106989379 TTAAACTATCCCTGCATCCCTGG + Intronic
1058746723 9:107998873-107998895 TTGCAGCCTCACTGGAGCCCTGG + Intergenic
1059017005 9:110530175-110530197 TTGAACCATCCCTGCATCCCTGG + Intronic
1059032989 9:110720913-110720935 TTAAACCATCCCTGCATCCCTGG - Intronic
1059075119 9:111184974-111184996 TTAAACCATCCCTGTATCCCTGG + Intergenic
1059630553 9:116117269-116117291 TTGAACCATCCCTGCATCCCTGG + Intergenic
1060014222 9:120072393-120072415 TTAAACTATCACTGCAGCTCGGG + Intergenic
1061586739 9:131574490-131574512 TCACACCACCACTCCAGCCTGGG - Intergenic
1061674535 9:132208340-132208362 TCACGCCAGCCCTGCAGCCCCGG + Intronic
1061678261 9:132230359-132230381 TTTCATCCTCACTTCAGCCCTGG - Intronic
1061751217 9:132778314-132778336 TAACTCCATTACTGCAGCTCTGG - Intronic
1062095765 9:134702331-134702353 TTGTCCCATCTCTGCAGCCCTGG - Intronic
1062109890 9:134776574-134776596 TGCCACCATCACTGCCACCCGGG - Intronic
1187108934 X:16275598-16275620 TTAAACCATCCCTGCATCCCTGG + Intergenic
1187152894 X:16697486-16697508 TTGCACCAGCACTTCAGCCTGGG - Intronic
1187218838 X:17304122-17304144 TTAAGCCATCCCTGCATCCCTGG + Intergenic
1187589162 X:20696974-20696996 TTAAGCCATCCCTGCATCCCTGG - Intergenic
1187681703 X:21773961-21773983 TTAAACCATCCCTGCCTCCCTGG - Intergenic
1187849003 X:23572312-23572334 TTAAACCATCCCTGCATCCCTGG - Intergenic
1188040206 X:25362915-25362937 TTAAACCATCCCTGCCTCCCTGG + Intergenic
1188725182 X:33574234-33574256 TTGAACCACCACTGCAACCCAGG + Intergenic
1188794054 X:34441049-34441071 TTAAACCATCACTGAATCTCTGG + Intergenic
1188825180 X:34823126-34823148 TTAAACCATGACTGCATCCCTGG - Intergenic
1188895052 X:35657318-35657340 TTAAACCATCCCTGCACCTCTGG + Intergenic
1188964426 X:36533982-36534004 TTAAACCATCCCTCCATCCCAGG + Intergenic
1189024716 X:37380888-37380910 TTACAGAATCAGTGCAGCCCTGG - Intronic
1189414037 X:40798562-40798584 TTAAACCATCCCTGCATCCCTGG - Intergenic
1189604126 X:42658066-42658088 TTAAACCATCCCTGCATCCCTGG - Intergenic
1189662949 X:43322869-43322891 TTAAACCATCCCTGCATTCCTGG + Intergenic
1189878828 X:45467801-45467823 TTAAACCATCCCTCCATCCCTGG + Intergenic
1190369693 X:49728674-49728696 TTAAACCATCCCTGCAACCCTGG + Intergenic
1190449256 X:50561550-50561572 TTAAACCATCCCTGCATCCCTGG - Intergenic
1190587189 X:51957883-51957905 TTGAACCATCATTGTAGCCCAGG + Intergenic
1190653972 X:52594886-52594908 TTAAACCATCCCTGCATTCCCGG + Intergenic
1191045620 X:56133337-56133359 TTAAACCATCCCTGCATCCCTGG - Intergenic
1191052106 X:56205483-56205505 ATTCACCATCATTGCATCCCAGG + Intergenic
1191065800 X:56346094-56346116 TTAAACCATCCCTGCATCCCTGG - Intergenic
1191077001 X:56465393-56465415 TTAAACCATCCCTGCATCCCTGG + Intergenic
1191692408 X:63953892-63953914 TTAAACTATCCCTGCATCCCTGG - Intergenic
1191770133 X:64746764-64746786 TTAAACCATTTCTGCATCCCTGG + Intergenic
1191784250 X:64900127-64900149 TTAAACCATCACTGCATCACTGG + Intergenic
1191804853 X:65124308-65124330 TTAAACCATCTCTGCATCCCTGG + Intergenic
1191806692 X:65143509-65143531 TTAAACCATCCCTGCATCTCTGG + Intergenic
1191888597 X:65916871-65916893 TTAAACCATCCCTGCATCTCTGG + Intergenic
1191892027 X:65954009-65954031 TTAAACCATCCCTGAATCCCTGG + Intergenic
1191905978 X:66090595-66090617 TTAAACCATCCCTGCTTCCCTGG + Intergenic
1191909107 X:66128341-66128363 TTAAACCATCCCTGCATCTCTGG + Intergenic
1191950817 X:66590376-66590398 TTAAACCATCCCTGCATCCTTGG + Intergenic
1191954483 X:66629012-66629034 TTAAACCATCCCTGCGTCCCTGG - Intronic
1191994382 X:67075619-67075641 TTAAACCATCCCTGCATGCCTGG - Intergenic
1192028001 X:67475726-67475748 TTAAACCATCTTTGCATCCCAGG - Intergenic
1192068837 X:67915680-67915702 TTAAACCATCCCAGCATCCCTGG + Intergenic
1192673719 X:73172381-73172403 TTAAACCATTTCTGCATCCCTGG + Intergenic
1192682981 X:73272166-73272188 TTAAACCATCCCTGCATGCCTGG - Intergenic
1192876912 X:75239771-75239793 TTAAACCAACTCTGCATCCCTGG - Intergenic
1192904020 X:75530456-75530478 TTGAACCATCCCTGCATCCCTGG + Intergenic
1192944042 X:75945651-75945673 TTAAACCATCCCTGCATCCCTGG + Intergenic
1192967946 X:76199948-76199970 TTACACCATCCCTGCATCCCTGG + Intergenic
1192969406 X:76215825-76215847 TTAAACTATCCCTGCATCCCTGG + Intergenic
1192985117 X:76390521-76390543 CTAAACCATCCCTGCATCCCTGG + Intergenic
1192987221 X:76412754-76412776 TTAAACCATCCCTGCATCCCTGG - Intergenic
1193015682 X:76730937-76730959 TTAAACCATCCCTGCATCCCTGG - Intergenic
1193016960 X:76744958-76744980 TTAAACCATCCCTGCAACCCTGG - Intergenic
1193020229 X:76783822-76783844 TTGAACCAGCACTGCATCCCAGG + Intergenic
1193155032 X:78163007-78163029 TTAAACCATCCCTGCATCCCTGG - Intergenic
1193174987 X:78382662-78382684 TTAAACCATCCCTACACCCCTGG - Intergenic
1193178513 X:78424437-78424459 TTGAACCATCCCTGCATCCCTGG - Intergenic
1193182456 X:78474177-78474199 TTAAAACATCCCTGCATCCCTGG + Intergenic
1193185838 X:78511297-78511319 TTAAACCATCACTCTATCCCTGG - Intergenic
1193190776 X:78567879-78567901 TAAAACCATCCCTGCATCCCTGG - Intergenic
1193421130 X:81283490-81283512 TTAAACCATCCCTGCATCCCTGG - Intronic
1193556939 X:82965837-82965859 TTAAACTATACCTGCAGCCCTGG + Intergenic
1193578821 X:83236231-83236253 TTAAACCATCCCTGCATCCCTGG - Intergenic
1193598774 X:83482335-83482357 TTAAACAATCCCTGCATCCCTGG + Intergenic
1193662370 X:84273038-84273060 CTAAACCATCCCTGCATCCCTGG - Intergenic
1193693182 X:84672940-84672962 TTAAACCATCTTTGCATCCCAGG - Intergenic
1193723301 X:85012671-85012693 TTAAACCATCCCTGCCTCCCTGG + Intronic
1193736472 X:85162860-85162882 TTAAACCATTCCTGCATCCCTGG + Intergenic
1193826181 X:86230281-86230303 TTAAACCATCCCTGCATCCCTGG + Intronic
1193875012 X:86851739-86851761 TTAAACTATCCCTGCATCCCTGG + Intergenic
1193930913 X:87550677-87550699 TTAAACCATCCCTGCATCCCTGG - Intronic
1193937827 X:87643725-87643747 TTAAACAATCACTGCATCCCTGG - Intronic
1194012255 X:88576853-88576875 TTAAACCATCCCTGAATCCCTGG + Intergenic
1194145503 X:90256536-90256558 TTAAACCACCCCTGCATCCCTGG - Intergenic
1194181784 X:90719044-90719066 TTAAACCATCTCTGCATCCCTGG - Intergenic
1194232325 X:91339759-91339781 TTAAACCATCCCTGCATTCCTGG - Intergenic
1194262972 X:91720237-91720259 GTAAACCATCCCTGCATCCCTGG - Intergenic
1194381391 X:93195959-93195981 TTAAACTATCCCTGCATCCCTGG - Intergenic
1194510399 X:94786829-94786851 TTAAGCCATCACTGCATCCTTGG - Intergenic
1194533846 X:95081598-95081620 TTAAACCATCCCTGCATTCCTGG - Intergenic
1194544803 X:95219640-95219662 TTAAACCATCCCTGCATCCCTGG + Intergenic
1194583283 X:95702558-95702580 TTAAACCATCCCTGCATTCCTGG + Intergenic
1194601644 X:95928397-95928419 TTAAACCATCCCTGCATCCCTGG - Intergenic
1194602359 X:95938050-95938072 TTACACCATCCCTGCATGTCTGG + Intergenic
1194606309 X:95983139-95983161 TTAAACCATCTCTGCATCCCTGG + Intergenic
1194617197 X:96119985-96120007 TTAAACCATCCCCGCATCCCAGG - Intergenic
1194874323 X:99167513-99167535 TTGAACCATCCCTGCATCCCTGG - Intergenic
1194881582 X:99258376-99258398 TTAAACTATCACTGCATCCCTGG + Intergenic
1194895971 X:99440217-99440239 TTAAACCATCCTTGCAACCCTGG - Intergenic
1194926353 X:99829730-99829752 TTAAACCACCCCTGCATCCCTGG + Intergenic
1194955877 X:100179927-100179949 TTAAACCATCCCTGCATCCCTGG - Intergenic
1194967657 X:100307221-100307243 TTAAACCATCCCTGCATGCCTGG - Intronic
1195015764 X:100778932-100778954 TTAAACCATCCCTGCATCCCTGG + Intergenic
1195122607 X:101770954-101770976 TTGAACCATCTCTGCATCCCAGG + Intergenic
1195131883 X:101861285-101861307 TCCCACCATCATTGCAACCCAGG - Intergenic
1195350349 X:103989796-103989818 TTACACCAGCCTTGCATCCCAGG - Intergenic
1195556687 X:106234905-106234927 TTAAACCATCCCTGCATCCCTGG - Intergenic
1195796087 X:108648560-108648582 TTAAACCATCACTGCATCCTTGG - Intronic
1195818323 X:108913335-108913357 TTAAACTATCCCTGCATCCCTGG - Intergenic
1195838591 X:109147438-109147460 TTAAACCATTCCTGCATCCCTGG - Intergenic
1195972447 X:110488164-110488186 TTAAATCATCCCTGCATCCCTGG + Intergenic
1195999565 X:110767012-110767034 TTAAACCATCCTTGCATCCCTGG - Intronic
1196161416 X:112488091-112488113 TTAAACCATCCCTGCATCCCTGG + Intergenic
1196204761 X:112926641-112926663 TTAAACCATCTTTGCATCCCTGG - Intergenic
1196219208 X:113091718-113091740 TTAAACCATCCCTGCATCCCTGG - Intergenic
1196244235 X:113380595-113380617 TTGAACCATCCCTGCATCCCTGG + Intergenic
1196336687 X:114544552-114544574 TTAAACCAACCCTGCATCCCTGG + Intergenic
1196465148 X:115964443-115964465 TTACACCATCCCTGCATCCCTGG - Intergenic
1196477364 X:116104258-116104280 TTAAACCATTTCTGCATCCCTGG + Intergenic
1196531055 X:116786692-116786714 TTAAACCATCCTTGCATCCCTGG - Intergenic
1196575439 X:117312744-117312766 TTAAACCATCCCTGCATCCCTGG + Intergenic
1196590231 X:117478786-117478808 TTAAACCATCCCTGCATCCCTGG + Intergenic
1196763300 X:119219960-119219982 GAACACCATACCTGCAGCCCAGG - Intergenic
1197054571 X:122101170-122101192 TTAAACCATCCCTGCATCCCTGG - Intergenic
1197065863 X:122233665-122233687 TTAAACCACCCCTGCATCCCTGG + Intergenic
1197102801 X:122676328-122676350 TTAAGCCATCCCTGCATCCCTGG - Intergenic
1197120387 X:122883965-122883987 TTAAACCATCCCTGCATCCCTGG - Intergenic
1197145205 X:123164477-123164499 TTAAGCCATCCCTGCAGCCTTGG - Intergenic
1197363881 X:125539837-125539859 TTAAACCATCCCTGCATCCTTGG - Intergenic
1197440332 X:126480488-126480510 TTAAACCATCCTTGCATCCCAGG - Intergenic
1197471904 X:126874007-126874029 TTAAACCATCTCTGCATCCCTGG + Intergenic
1197476003 X:126926287-126926309 TTAAATCATCCCTGCATCCCTGG + Intergenic
1197504261 X:127281983-127282005 TTAAACCATCCCTGCATCCCTGG - Intergenic
1197515234 X:127419684-127419706 TTAAACCATCCCCGCATCCCTGG + Intergenic
1197519242 X:127476546-127476568 TTAAAACATCCCTGCATCCCTGG - Intergenic
1197556511 X:127961857-127961879 TTAAATCATCCCTGCATCCCAGG + Intergenic
1197589205 X:128387616-128387638 TTATACCATCCCTGCATCCCTGG - Intergenic
1197611801 X:128647631-128647653 TTAAACCATCCCTGCCTCCCTGG - Intergenic
1197664297 X:129207032-129207054 TTAAACCATCCCTGCATCCCTGG + Intergenic
1197668758 X:129252548-129252570 TTAAACCATCCCTGCATCCCTGG + Intergenic
1197911300 X:131485490-131485512 TTAAACCATCCCTGTATCCCTGG - Intergenic
1197954011 X:131927242-131927264 TTAAACCATACCTGCATCCCTGG - Intergenic
1198008828 X:132529312-132529334 TTAAACCATCCCTGCATCCCTGG + Intergenic
1198267810 X:135026320-135026342 TTAAACCATCCCTGTATCCCTGG + Intergenic
1198583201 X:138090094-138090116 TTAAACTATCCCTGCATCCCTGG - Intergenic
1198604194 X:138318746-138318768 TTAAAACATCCCTGCATCCCTGG + Intergenic
1198616824 X:138467006-138467028 TTAAACCATCCCTGCATCCTCGG - Intergenic
1198796828 X:140406130-140406152 TTAAACCATCCTTGCATCCCTGG + Intergenic
1198987116 X:142467510-142467532 TTAAACCGTCTCTGCATCCCTGG + Intergenic
1199044202 X:143149545-143149567 TTAAACCATCCCTGCATTCCTGG - Intergenic
1199048973 X:143212710-143212732 TTAAACCCTCTCTGCATCCCTGG + Intergenic
1199061680 X:143363074-143363096 TTAAACCATCATTGCATCCAAGG + Intergenic
1199206212 X:145151567-145151589 TTAAACCATCCCTCCATCCCTGG - Intergenic
1199324759 X:146485086-146485108 TTGAACCATCATTGCATCCCTGG + Intergenic
1199358359 X:146886972-146886994 AGCCACCACCACTGCAGCCCAGG - Intergenic
1199424592 X:147686045-147686067 TTAAACCATCCCTGCATCCCTGG - Intergenic
1199564482 X:149199741-149199763 TTAAACCAACCCTGCAGCCCTGG + Intergenic
1199668869 X:150124635-150124657 TTAAACAATCCCTGCATCCCTGG - Intergenic
1199913974 X:152318647-152318669 TTAAATCATCCCTGCATCCCTGG - Intronic
1200317788 X:155152140-155152162 TTAAACCATCCCTGCATCTCTGG + Intergenic
1200333011 X:155317877-155317899 TTAAACCATCCCTGCATCCCTGG - Intronic
1200371538 X:155730358-155730380 TTGAACCATCATTGCATCCCTGG - Intergenic
1200415190 Y:2902621-2902643 TTAAACCATCTCTGCATCCCTGG - Intronic
1200491256 Y:3825836-3825858 TTAAACCACCCCTGCATCCCTGG - Intergenic
1200528408 Y:4300960-4300982 TTAAACCATCTCTGCACCCCTGG - Intergenic
1201391888 Y:13507066-13507088 TTAAACCATCCCTGCATCCCTGG - Intergenic
1201930689 Y:19342704-19342726 TTAAACCATCTCTGCATCCCTGG + Intergenic
1201934432 Y:19392359-19392381 TTAAAGCATCCCTGCATCCCTGG + Intergenic
1202043932 Y:20717743-20717765 TTATACCATCCCTGCATCACTGG - Intergenic