ID: 988506160

View in Genome Browser
Species Human (GRCh38)
Location 5:31825214-31825236
Sequence AATCCAGATGTGGTTCCGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988506160_988506165 28 Left 988506160 5:31825214-31825236 CCAAACGGAACCACATCTGGATT 0: 1
1: 0
2: 0
3: 8
4: 84
Right 988506165 5:31825265-31825287 CCCGTACTACAGTTACAGAATGG 0: 1
1: 0
2: 0
3: 2
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988506160 Original CRISPR AATCCAGATGTGGTTCCGTT TGG (reversed) Intronic
903362836 1:22787789-22787811 AATCCAGGTGTGGTTTAGCTGGG + Intronic
906541481 1:46589845-46589867 AGTACAGATCTGGTTCCTTTGGG - Intronic
906768873 1:48464730-48464752 AGTCAAGATGTGGTTACCTTTGG + Intronic
915661941 1:157411935-157411957 AATCCAGGTGTGGTTCAGCTGGG + Intergenic
915886279 1:159724860-159724882 AATTCAAATGTTGTTCAGTTAGG + Intergenic
916837298 1:168560000-168560022 AATCTAGATGTGTTTGGGTTTGG + Intergenic
917083810 1:171285304-171285326 GAGCCAGATGTGGATCCGTTAGG - Exonic
919657832 1:200214568-200214590 AAAGCAGATGTGGCTCCTTTGGG - Intergenic
921715832 1:218416471-218416493 AATCCAGATTTGTCTCCTTTGGG - Intronic
1067578087 10:47420340-47420362 GATGCAGATGTGGCTCCATTTGG + Intergenic
1073448321 10:103594009-103594031 AATTAAGAGGTGATTCCGTTCGG + Exonic
1080074558 11:28134078-28134100 AGTTCACATGTTGTTCCGTTAGG - Intronic
1080812929 11:35723694-35723716 CATACACATGTGGTTCAGTTAGG - Intronic
1081185850 11:40041565-40041587 AATTCAGATGTGAATCCGTCTGG - Intergenic
1083519380 11:63293905-63293927 AATTCAGCTGTGATTCTGTTTGG + Intronic
1083543641 11:63532915-63532937 CATCCTGATGTGGGTCAGTTTGG + Intergenic
1086756690 11:90572826-90572848 AATTCAGATGTGACTCCATTTGG + Intergenic
1087023087 11:93622609-93622631 CAGCCAGATGTGGTGCTGTTTGG - Intergenic
1088701198 11:112413622-112413644 AATCCAGATGTGGCTTAGTTAGG - Intergenic
1092159200 12:6306674-6306696 AAAGCAAATGTGGTTCCTTTGGG + Intergenic
1098086531 12:66850312-66850334 AATCCAGATGTGGGTTCCTGAGG + Intergenic
1099562205 12:84192624-84192646 AAGCCAAATGAGGTTCCCTTAGG - Intergenic
1105586894 13:21754102-21754124 AATCTAGATGTACTTTCGTTAGG + Intergenic
1108144973 13:47467077-47467099 AATTCAGCTGTGATTCCGTCTGG - Intergenic
1109659443 13:65438919-65438941 AATTCAGCTGTGGATCCGTCTGG - Intergenic
1112905269 13:104410662-104410684 AATCCAGATGGGGTTCTGCTGGG + Intergenic
1115843456 14:37498730-37498752 AATCCTGAAGTGGTTTCATTTGG + Intronic
1119980569 14:79076344-79076366 AATCCAGATGTGGCTTAGCTGGG + Intronic
1129109700 15:73330207-73330229 AAACCAGATATGCTTCCCTTGGG + Intronic
1136119937 16:28126264-28126286 ACTCCAAATCTGGTTCCTTTAGG + Intronic
1138174591 16:54885109-54885131 AATCCAAATGTGGTTTAATTTGG - Intergenic
1147369839 17:39984740-39984762 ACTCCAGTTGAGGTTGCGTTGGG + Intronic
1157843401 18:50980183-50980205 AAGCCAGATGTGGTCCCAGTGGG + Intronic
1159604099 18:70457275-70457297 AATCCAGGTGTAGTTTCCTTGGG + Intergenic
1163059916 19:14753179-14753201 ATTCCAGGTGTGGGCCCGTTAGG + Intronic
1165279877 19:34786727-34786749 AATCTAGATGTGGCTCCTTTAGG - Intergenic
1168614024 19:57823295-57823317 AAGCCATATGTGGTTCTGTGTGG + Intronic
1168618043 19:57854300-57854322 AAGCCATATGTGGTTCTGTGTGG + Intronic
1168625303 19:57913348-57913370 AAGCCATATGTGGTTCTGTGTGG - Intronic
926444139 2:12923286-12923308 AATCCAGTTCTGTTTCAGTTTGG - Intergenic
936484033 2:112911340-112911362 AATTCAGATGTGCTTCCAGTGGG - Intergenic
940055596 2:149509662-149509684 AATCCAGGTGTGGTTTGGCTGGG + Intergenic
940692916 2:156941784-156941806 AATCAAGGTATGGTTCCCTTGGG + Intergenic
941753910 2:169164275-169164297 GTTCCAGATGTGGTTCCTCTTGG - Intronic
942936200 2:181559587-181559609 AAACCAGATCTGGGTCCATTAGG - Intronic
1178212298 21:30549880-30549902 AATTCAGATGTGACTCTGTTTGG + Intronic
1179951435 21:44710916-44710938 ACTCCAGAGGTGGTTGTGTTTGG + Intronic
1180112257 21:45665657-45665679 AATTCAGCTGTGATTCCATTTGG - Intronic
1183609028 22:38884745-38884767 TATCAGGATGTGGTTCCCTTAGG - Intergenic
953043335 3:39274061-39274083 CATTCAGATGAGGTTCTGTTTGG + Intronic
956817969 3:72925699-72925721 AATTCAAATGTAGTTCCATTGGG - Intronic
957092730 3:75748226-75748248 AATTCAGCTGTGATTCCGTCTGG - Intronic
958663576 3:97104746-97104768 AATCCAGCTGTGAATCTGTTTGG + Intronic
959218225 3:103480760-103480782 AATTCAGCTGTGGATCCGTCTGG + Intergenic
960966297 3:123107147-123107169 AATCCAGATGTTGTTAGGATTGG + Intronic
963816795 3:149839690-149839712 ATTCAAGATGTGGTTTGGTTGGG + Intronic
972275832 4:37556661-37556683 AATCCTGAGGTGGTTCAGGTAGG - Intronic
973782073 4:54297681-54297703 ATTCCAGATTTGTTTCCTTTTGG + Exonic
975427293 4:74245221-74245243 AATCCAGCTGTCTTTCTGTTAGG + Intronic
977846259 4:101771497-101771519 TATCCTGATGAGGTTCCCTTTGG + Intronic
979995711 4:127428368-127428390 AATTCTGCTGTGGATCCGTTTGG - Intergenic
980002158 4:127502496-127502518 AATGCAAATGTGGTTTTGTTTGG - Intergenic
980802337 4:137768598-137768620 AGTCCACATGTGATTACGTTTGG + Intergenic
985803763 5:2023159-2023181 AATACAGATTTGCTTCCTTTGGG - Intergenic
988506160 5:31825214-31825236 AATCCAGATGTGGTTCCGTTTGG - Intronic
989585212 5:43069101-43069123 AATACAGATGTGGTAGAGTTGGG + Intronic
990726359 5:58759245-58759267 AACCCAGATGTGGTGGGGTTGGG + Intronic
996014122 5:118512317-118512339 AATTCAGATGTGGTGCAGTAGGG + Intergenic
999619918 5:153462441-153462463 AATCCAGATTAGGTTCCCTTTGG + Intergenic
1000697954 5:164412570-164412592 ATTACAGATGTGTTTCCTTTTGG - Intergenic
1002772349 6:300811-300833 CATCCAAATGTGGTTACCTTAGG + Intronic
1003557804 6:7156515-7156537 AACCCAGATGTGGCTCAGTGCGG - Intronic
1005979646 6:30827202-30827224 AGCCCAGGTGTGGTGCCGTTTGG + Intergenic
1011454525 6:87533612-87533634 AAACCAGTTGTGTTTCCTTTAGG + Intronic
1012685481 6:102242958-102242980 AATTCAGATGTGATTTGGTTAGG - Intergenic
1012865768 6:104616197-104616219 AATCCAGATGTGGCTTAGTGAGG - Intergenic
1013968095 6:115980461-115980483 AATCCAGCTGAGGTTCCTTGTGG + Intronic
1021346160 7:19531094-19531116 AATTCAGATGTGGTTTCCCTAGG - Intergenic
1024888980 7:54179827-54179849 AGTCCACATGTGGTTCATTTTGG + Intergenic
1028677943 7:93489796-93489818 AATTCAGCTGTGGATCCATTTGG - Intronic
1036920916 8:12854485-12854507 AATACAGATGTGGTTGCGTCCGG + Intergenic
1043579345 8:81693954-81693976 AATCTAGAGGTGATTCTGTTGGG - Exonic
1046694586 8:117325426-117325448 TGTACAGATGTGGTTCCTTTTGG - Intergenic
1048851278 8:138647332-138647354 AATCCAGAAGTGGTTTCGCTGGG - Intronic
1049085374 8:140474398-140474420 CATCCAGATGAGATTCAGTTCGG + Intergenic
1049525086 8:143121153-143121175 AATCCTGATGTGGTGATGTTCGG - Intergenic
1051602762 9:18891157-18891179 AAGCCAGATGTGGCGCCGCTTGG + Intronic
1052326808 9:27224148-27224170 AATTCAGCTGTGGATCCGTCTGG - Intronic
1187507715 X:19890004-19890026 ATTCCAGAGGTGGTTCTCTTTGG + Intergenic
1188916634 X:35919756-35919778 AAAACAGATGTGGATCCGTCCGG - Exonic
1193434272 X:81452778-81452800 AATTCAGATGTGAATCCGTCTGG - Intergenic
1198612444 X:138417217-138417239 AAATCAGATGTGGTTTGGTTTGG + Intergenic
1201651989 Y:16298937-16298959 AATCCAGATGTGAATCTGTCTGG - Intergenic