ID: 988507107

View in Genome Browser
Species Human (GRCh38)
Location 5:31833170-31833192
Sequence CTAGAAACAAAGGTGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 1, 2: 1, 3: 42, 4: 390}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988507107 Original CRISPR CTAGAAACAAAGGTGGAGGC TGG Intronic
900093119 1:929127-929149 CTAGAAACACTGGAGGAGTCCGG + Intronic
900326719 1:2111758-2111780 CAAGAAACAAGGGTGGAGCCAGG - Intronic
900905268 1:5552674-5552696 CTGGAAATAAAGGTGGAGAGGGG + Intergenic
901539683 1:9907876-9907898 TAAGGAGCAAAGGTGGAGGCAGG - Intronic
902121189 1:14167424-14167446 CTAAATACAAGGATGGAGGCAGG + Intergenic
902167105 1:14581490-14581512 CCAGAGACAAAAGTGAAGGCAGG - Intergenic
903825978 1:26146049-26146071 CTAGAACCAATGGAGGAGGAGGG - Intergenic
904136177 1:28314272-28314294 CTGGACAGAAAGGTGGAGCCTGG + Intergenic
904808067 1:33145658-33145680 CTAGAAAGAAAAGTCAAGGCCGG + Exonic
904812362 1:33171737-33171759 TTGGAAACCAAGGTGGAGGGAGG - Intronic
905049384 1:35036688-35036710 ATAGAACAAAAGGTGGAGGAAGG + Intergenic
906660602 1:47578732-47578754 CAAGAAAAAAAGGTGGGGGGAGG - Intergenic
907512092 1:54969370-54969392 CTAGAACAAAAGGTGGTAGCTGG + Intergenic
908619635 1:65963180-65963202 GTAAAAATAAAGGTGGGGGCAGG - Intronic
910030150 1:82710159-82710181 CCAGAAACAAAGGTATAGCCTGG - Intergenic
910884978 1:91954657-91954679 TTAGAAGCAATAGTGGAGGCTGG + Intronic
911089823 1:94009566-94009588 CTGGAAACACATGCGGAGGCTGG - Intronic
913466746 1:119150705-119150727 CCTGAAATCAAGGTGGAGGCAGG - Intergenic
915828103 1:159100526-159100548 CTATTAAAAAAGGTGGAGGCAGG + Intronic
916052960 1:161048964-161048986 CCAGAGACCAAGGTGGAGGCTGG - Exonic
916327395 1:163578301-163578323 ATAGAACAAAAGGTGGAGGAAGG + Intergenic
916865034 1:168847570-168847592 CTTGAAAGAAATCTGGAGGCTGG + Intergenic
917633021 1:176908403-176908425 CTAGAAAGAAAGGAGAAGGCAGG + Intronic
917687083 1:177427823-177427845 TTGGAAAGAAAGGTGGAAGCAGG - Intergenic
918122004 1:181548489-181548511 CCAGAAACATAGGAGGAGGCAGG - Intronic
918298236 1:183178005-183178027 TTAGAAACAAAATGGGAGGCAGG + Intergenic
919986559 1:202679806-202679828 CTAGAAAGAAGGGAGGAGGCTGG - Intronic
920733488 1:208510691-208510713 AGAGAAAGAAAGGTGGAAGCAGG + Intergenic
920869686 1:209783710-209783732 CTAGAAACAAAGCAGGAGCAGGG + Intronic
921278296 1:213540990-213541012 CTAGAATTACAGGTGGAGCCTGG - Intergenic
922013126 1:221612707-221612729 CTAGACACAAAGTAGGAAGCTGG - Intergenic
922226021 1:223646497-223646519 GAAGAGAAAAAGGTGGAGGCAGG - Intronic
922366441 1:224868816-224868838 TCAGAAGCAAAGGTGGAAGCTGG + Intergenic
922766919 1:228160748-228160770 ACAGAACCAAAGGTGGAGGAAGG - Intergenic
922924489 1:229336437-229336459 CTGGGAACAGAGGTGGAGGAAGG - Intronic
923577225 1:235170440-235170462 TTAAAAACATAAGTGGAGGCCGG + Intronic
924423424 1:243930523-243930545 CAAGATTCAAAGGTGGAGGTTGG - Intergenic
1063137594 10:3230720-3230742 CTAGAAACAAGAGAGAAGGCTGG + Intergenic
1063390202 10:5645337-5645359 CTAAGAACAAAGGTGGAAGCAGG + Intronic
1064469226 10:15618347-15618369 CAAAAAACAAAGGTGGAGGGAGG + Intronic
1065118359 10:22504202-22504224 CTATCCACAAAGGTGGACGCTGG - Intergenic
1065568322 10:27040731-27040753 CAAGAAACAAAGGAAGTGGCCGG + Intronic
1068463087 10:57351895-57351917 GTAGAAGCCAAGGTGGGGGCAGG - Intergenic
1068734191 10:60393310-60393332 CTAGTAACAAAGCTGCAAGCAGG - Intronic
1068848379 10:61706952-61706974 CTTTATACAAAGGTGCAGGCTGG - Intronic
1069006484 10:63323225-63323247 CTAGAAACAACAGTGGTGCCGGG + Intronic
1069596586 10:69675917-69675939 ATAGAACAAAAGGTGGAGGAAGG - Intergenic
1070221525 10:74451616-74451638 TCAGAAAGAAAGGTGGAGGTGGG + Intronic
1071058213 10:81535887-81535909 CTAGAAATAAAGGTGGGCACTGG + Intergenic
1071124473 10:82318248-82318270 TAGGAACCAAAGGTGGAGGCAGG + Intronic
1072007144 10:91263011-91263033 CTATAAACAAAGATGGAAGGGGG + Intronic
1072418789 10:95271785-95271807 CTAGAAAAAAAGGGGAAAGCAGG + Intronic
1072595984 10:96872394-96872416 TTACAAATAAAGGAGGAGGCTGG + Intronic
1072835905 10:98711643-98711665 CGAGAAACAAAGGTAGTGTCTGG + Intronic
1072946613 10:99816260-99816282 CAAAAAACAGAGATGGAGGCCGG - Intronic
1073577636 10:104639618-104639640 CTATTAAGAAAGGAGGAGGCAGG - Intergenic
1074401637 10:113145960-113145982 CTTGAAACAAGGGTGGGGGTGGG - Intronic
1075562587 10:123479190-123479212 GTAGACACCAAGGTCGAGGCTGG - Intergenic
1078509026 11:11972152-11972174 TTAAAAACAAAGATGAAGGCAGG + Intronic
1079282071 11:19096566-19096588 CTAGAAACACAGCTGGAGACTGG + Intergenic
1081582301 11:44360619-44360641 CTAGAAACACTGATGTAGGCAGG - Intergenic
1081600329 11:44488353-44488375 CCAGAGACAAGGCTGGAGGCCGG + Intergenic
1081799179 11:45846180-45846202 TTAGAAACAAAGATGGAAGAGGG + Intergenic
1082083832 11:48032919-48032941 ATAGAAACAAAAGTGTAGGCTGG + Intronic
1082762646 11:57142462-57142484 CAAGAAACAAAGCAGGAAGCTGG + Intergenic
1083402089 11:62430574-62430596 CTAAAAACCAAGGTGTTGGCAGG + Intergenic
1083549445 11:63575390-63575412 CTAGAAGCAAAGGTGGAGTCAGG + Intronic
1084230630 11:67750128-67750150 TTAGAAAAATAAGTGGAGGCTGG + Intergenic
1084397267 11:68920392-68920414 GTTGAAAGAAAGGTGGGGGCTGG - Intronic
1084572634 11:69968762-69968784 CACGAAAGAGAGGTGGAGGCTGG - Intergenic
1085173324 11:74466859-74466881 CCAGTAACATAGGTCGAGGCTGG - Intronic
1086767613 11:90717737-90717759 CTAGAAACAAAGGTGGAGGTGGG - Intergenic
1088515951 11:110634027-110634049 CTATGAACAAAGATGGAGACTGG + Intronic
1088536270 11:110865515-110865537 GTAGAAACAATGGTGGAAACTGG - Intergenic
1089083534 11:115797746-115797768 GTGGAGACAAAGCTGGAGGCAGG + Intergenic
1089164448 11:116464323-116464345 ATAGAACAAAAGGTGGAGGAAGG + Intergenic
1089318382 11:117607538-117607560 CTAGCTACAGAGGTGCAGGCAGG + Intronic
1089488976 11:118869894-118869916 CTAAACACAAATGTGGGGGCTGG + Intergenic
1089916049 11:122157795-122157817 CTAGAAAGGAAGTTGTAGGCTGG - Intergenic
1090329347 11:125918441-125918463 TTAGAAACACAGGCGGAGGGAGG + Intronic
1090823602 11:130367176-130367198 CAAAAAACAAAGGTCTAGGCCGG - Intergenic
1091979410 12:4853309-4853331 CTCGAGAGAAAGGTGGAGGCTGG - Intergenic
1092795940 12:12110383-12110405 GTAGAAAACAATGTGGAGGCCGG - Intronic
1093614117 12:21200095-21200117 CAAAAAACAAAAGTGAAGGCCGG - Intronic
1094017630 12:25881695-25881717 CTTGAAGTAAAGGTAGAGGCCGG - Intergenic
1094156867 12:27346557-27346579 TTAAAAACAAAGGTTTAGGCCGG - Intronic
1094474618 12:30831838-30831860 ATAGAAAGAAAGATGGAGGGAGG - Intergenic
1096565463 12:52473990-52474012 CTCGAGTCAAAGCTGGAGGCAGG - Intergenic
1097893335 12:64800252-64800274 CTAGATACAAAACTAGAGGCTGG + Intronic
1099345417 12:81493819-81493841 ATAGAAACATAGATGAAGGCAGG + Intronic
1099853793 12:88138867-88138889 CTAGTAACTGAGGTGGAGGGTGG - Intronic
1100373373 12:93990314-93990336 TTAGAATCATAGGTTGAGGCTGG - Intergenic
1101032962 12:100677970-100677992 CAGGAAGCAAAGGTGGAAGCAGG - Intergenic
1101623701 12:106417355-106417377 CTGGAGACCCAGGTGGAGGCTGG + Intronic
1101627389 12:106458677-106458699 CAAGAAACAAAGGCAGAGGGAGG - Intronic
1102275556 12:111579556-111579578 TTAAAAATAAAGCTGGAGGCCGG - Intronic
1102826308 12:115950409-115950431 TTAGAAACCAAGATGGAGGGTGG - Intergenic
1102954759 12:117052299-117052321 TTAGGAACAAAGGCTGAGGCTGG + Intronic
1103375583 12:120453044-120453066 CTAGAAATAAAGTAGGAGGAAGG + Intronic
1103587102 12:121963942-121963964 CTGGAAAGAAGGATGGAGGCAGG + Intronic
1104455856 12:128911650-128911672 TTAGATGGAAAGGTGGAGGCAGG - Intronic
1104503020 12:129303950-129303972 CAGAACACAAAGGTGGAGGCAGG - Intronic
1104509418 12:129363044-129363066 CAATAAACAAAGATGGAGGAAGG - Intronic
1106208587 13:27621129-27621151 CTGGGAACAAAGGTGAGGGCGGG + Exonic
1106590131 13:31091643-31091665 CGGGAAGCAAAGGTGGAGACTGG - Intergenic
1107336274 13:39359174-39359196 CTAAAAACATAGGTGTTGGCAGG + Intronic
1107612022 13:42124754-42124776 ATAAAAACAAAGGCGGAGGAGGG + Intronic
1107989010 13:45800985-45801007 CTAAAATCAAAGGTGGACACAGG - Intronic
1108302994 13:49099226-49099248 CTAGAGATCAAGGTGGAAGCTGG - Intronic
1108424368 13:50283846-50283868 CAAGAAACAAATGTGCAGGAGGG - Intronic
1108746012 13:53395077-53395099 ATAGAACAAAAGGTGGAGGAAGG + Intergenic
1109588273 13:64439892-64439914 TTAGATACCAAGGAGGAGGCTGG + Intergenic
1112511665 13:100015302-100015324 AAAAAACCAAAGGTGGAGGCCGG + Intergenic
1112580342 13:100672786-100672808 CTGTAAAAAATGGTGGAGGCCGG - Intronic
1113083777 13:106546357-106546379 GTAGAAACAAAGCTGGAGCCAGG - Intronic
1113737027 13:112686301-112686323 TTGGAAAGAAAGGTGGAGGGAGG + Intergenic
1116393589 14:44422267-44422289 CTAGACACAACGGAGGATGCAGG + Intergenic
1116490828 14:45500999-45501021 CTAGAAAGAAAGGAGGAGGGAGG - Intergenic
1117318286 14:54596186-54596208 CTACTAACAAAGATGTAGGCAGG + Intronic
1117318914 14:54602003-54602025 GTAGAAACAAAGGAGAAAGCAGG + Intronic
1117915394 14:60672725-60672747 ATAAAAAGAAAGCTGGAGGCTGG - Intergenic
1118010442 14:61605270-61605292 CTAGAAAGAAAAGTTGAGGGGGG + Intronic
1118310599 14:64689866-64689888 TTAGAAAGAAAGGTGGGGGTTGG + Intergenic
1118970737 14:70635404-70635426 CTAAAAACAAAGTTAGAGGCCGG + Intergenic
1118985825 14:70753811-70753833 CTAGGATCAGAGGTGGAGGAGGG + Intronic
1119164394 14:72480327-72480349 GAGGAAACCAAGGTGGAGGCGGG + Intronic
1121334458 14:93069006-93069028 CCAGAAACAAGGGAGGAGTCTGG + Intronic
1121663294 14:95652013-95652035 AAAGAAAACAAGGTGGAGGCAGG - Intergenic
1122276882 14:100595305-100595327 CTAGGAACAGGGGTGGAGGGAGG - Intergenic
1122887529 14:104716986-104717008 CTAAATAAAAAGGTGGGGGCTGG - Intronic
1122935810 14:104955584-104955606 CTGAAGACAGAGGTGGAGGCAGG - Exonic
1125174396 15:36804352-36804374 CTAGAGACAGGGGTGCAGGCAGG - Intronic
1125385352 15:39130929-39130951 CTGGAGGCAAAGGTGGGGGCGGG - Intergenic
1125593803 15:40872086-40872108 CTAGATTGAAAGGTGGGGGCTGG - Intergenic
1126888722 15:53180827-53180849 CTAACAACAAAGGTGTTGGCAGG - Intergenic
1127494170 15:59493882-59493904 TTAGAAAAGAAGGAGGAGGCCGG - Intronic
1128120315 15:65141366-65141388 CTAGAAGCTAAGGCGGGGGCCGG - Intergenic
1128792380 15:70442724-70442746 CGAGAAACAGAGCTGGAGTCCGG - Intergenic
1131563553 15:93464907-93464929 ATAGAACAAAAGGTGGAGGAAGG - Intergenic
1133036905 16:3038638-3038660 CTAGAAAAATAGGAGGAGGGTGG + Intergenic
1133199066 16:4191314-4191336 CTCAAAACCCAGGTGGAGGCCGG + Exonic
1133390510 16:5406333-5406355 ATAGAACAAAAGGTGGAGGAGGG + Intergenic
1133786760 16:8979857-8979879 CTAAAAACAAAACTAGAGGCCGG - Intergenic
1133790813 16:9008113-9008135 GTAGAGACAAGGGTGGGGGCGGG + Intergenic
1133931930 16:10239732-10239754 ATAGAACCAAAGGTGGAGGGAGG - Intergenic
1134838120 16:17379067-17379089 CCAGAAACAAAGGAAAAGGCAGG + Intronic
1136854470 16:33643182-33643204 TTAGAAACAATGTTGGAGTCTGG + Intergenic
1137028406 16:35500587-35500609 CTAAAAATATAGGGGGAGGCAGG - Intergenic
1137804458 16:51290687-51290709 GCAGAAACATAGGTGGAGGCAGG + Intergenic
1138367501 16:56493088-56493110 GTAAAAAGCAAGGTGGAGGCTGG + Intronic
1138770242 16:59654090-59654112 ATAGAAAGAAAGATGGGGGCGGG + Intergenic
1139125643 16:64073058-64073080 CTCTAAACAAAGGTGGAGAAAGG - Intergenic
1140233796 16:73140557-73140579 CCTGAAACAAATGGGGAGGCCGG + Intronic
1203116046 16_KI270728v1_random:1491644-1491666 TTAGAAACAATGTTGGAGTCTGG + Intergenic
1143297596 17:5883137-5883159 CGAGAAACAGGGGTGGAAGCTGG - Intronic
1143453117 17:7048499-7048521 CTAAAAACAAAAGAGAAGGCCGG + Intergenic
1143551747 17:7634573-7634595 CTGGAAAAAGGGGTGGAGGCAGG + Intergenic
1145216432 17:21056051-21056073 CTTCAAACAAAGGTAGAGGAAGG - Intergenic
1145746628 17:27324925-27324947 CCAGAAACCAAGGAGGAAGCTGG + Intergenic
1145817786 17:27807971-27807993 CTTGAAACAGAGGTGGGGTCTGG + Intronic
1145873488 17:28296643-28296665 CCAGAAACATGGGTGGAAGCTGG - Intergenic
1147391420 17:40111660-40111682 TTAGAGAGAAAGGTTGAGGCTGG + Intergenic
1147596692 17:41722615-41722637 CTAGAGAGACAGCTGGAGGCTGG + Intronic
1148009470 17:44464499-44464521 CCAGAAACATGGGTGGAAGCTGG - Exonic
1149301167 17:55305594-55305616 CTAGAAAGCCAGGGGGAGGCTGG - Intronic
1150743035 17:67794999-67795021 CTGGAAACAAAGTCAGAGGCAGG - Intergenic
1151060246 17:71084126-71084148 CTAGATACCAAGGTGGAGAAGGG - Intergenic
1151172543 17:72259489-72259511 CTTTAAAAAAAGGTGGTGGCAGG + Intergenic
1151226180 17:72649887-72649909 CAAGAAACAGAGGTGTAGGCTGG - Intronic
1151295517 17:73183189-73183211 CTACATACAGAGGTGGGGGCAGG + Intergenic
1151775418 17:76198055-76198077 CCAGAAAGGAAGGTGGGGGCAGG - Intronic
1152214007 17:79021826-79021848 CTAGAAAGACAGCTGAAGGCTGG - Intergenic
1152802303 17:82336708-82336730 CTAGAACCCGAGGTGGCGGCGGG - Intergenic
1152804641 17:82349459-82349481 ATAAACACAAAGGTGGAGACTGG + Intergenic
1153595530 18:6721340-6721362 CTGGAGACAAAGCTGGAGACAGG - Intergenic
1153645789 18:7194959-7194981 TTAGAAATAGAGGAGGAGGCTGG - Intergenic
1157943735 18:51956151-51956173 AAAAAAAAAAAGGTGGAGGCAGG + Intergenic
1158725502 18:59968224-59968246 CAAGAGACAGAGATGGAGGCAGG + Intergenic
1158782699 18:60670001-60670023 CTCCAAACAAAGGTGGAAGCTGG + Intergenic
1158821006 18:61158824-61158846 ATAGAAGAAAAGGTGGAGGAAGG - Intergenic
1159894737 18:73985573-73985595 CTAGGAACAAGGGTGGGGCCTGG - Intergenic
1161118224 19:2511382-2511404 CTAGAACCACAGGCGGCGGCTGG + Exonic
1161241492 19:3225781-3225803 CTTGAGCCCAAGGTGGAGGCGGG - Intronic
1161324030 19:3654466-3654488 CTACAAAAATAGGTGGTGGCCGG - Intronic
1162901399 19:13797011-13797033 CTAGAAACCCAGGTGGAGTAGGG + Intronic
1163043078 19:14617083-14617105 CTAGAAAAAAAGGTGGGGTGTGG - Intergenic
1163803861 19:19384776-19384798 TCAGAAACGAAGGTGGAGGGGGG + Intergenic
1164771257 19:30811021-30811043 CTAGAATCAAAGCTGGGGGAGGG - Intergenic
1165239934 19:34458257-34458279 TTAGAAAAGAAGGTTGAGGCCGG + Intronic
1165410541 19:35658086-35658108 GTATAAACAATGATGGAGGCTGG - Intronic
1165706652 19:37980906-37980928 CTAGAAAGAACTGAGGAGGCAGG - Intronic
1167411320 19:49345678-49345700 ATAGTAACAAAGGTGGTGGAGGG - Intronic
1168081070 19:54010875-54010897 CTAAAAATAAAAGAGGAGGCTGG - Intronic
1168230646 19:55028836-55028858 AGAAAAACAAAGGTTGAGGCTGG + Intronic
928168139 2:28985590-28985612 CGATACACAAAGGTGGGGGCAGG + Intronic
928520585 2:32084587-32084609 ATAGAAAAAATGGTTGAGGCTGG + Intronic
929693084 2:44090738-44090760 CTATTTACAAAGGTGCAGGCAGG - Intergenic
930108728 2:47659643-47659665 CAAGAATTAGAGGTGGAGGCAGG - Intergenic
930831954 2:55753948-55753970 GTAGAATAAAAGGTGGAGGAAGG - Intergenic
931784861 2:65609469-65609491 CTAGAAACAAAGAAGGAGGTGGG - Intergenic
932022654 2:68103396-68103418 CTAGAAACAAAGATGAAAGGAGG - Intronic
933546499 2:83719729-83719751 TTAGAAATAAAGTTGGAGTCAGG - Intergenic
934695838 2:96399668-96399690 CCAGACACCAGGGTGGAGGCAGG - Intergenic
935444091 2:103137979-103138001 CAAGAAAGAAAGATGTAGGCCGG - Intergenic
936841816 2:116778811-116778833 TTACAAAGAAAGATGGAGGCTGG + Intergenic
938867458 2:135437951-135437973 ATAGAAAAAAAGGTAGAGGAAGG + Intronic
939062403 2:137438568-137438590 TTACAAAAACAGGTGGAGGCTGG + Intronic
939097607 2:137852479-137852501 CTAGTTAGAAAGCTGGAGGCAGG + Intergenic
939754991 2:146099351-146099373 CTAGAACCAAAGATGGATGGTGG - Intergenic
940112193 2:150167206-150167228 CTAGAAACAGAGGCCGAGGCGGG + Intergenic
940402988 2:153268206-153268228 CTAGATACAATGGTGGGGGGTGG + Intergenic
940574948 2:155491324-155491346 ATACAAACTAAGGTGGAAGCCGG + Intergenic
942358281 2:175143791-175143813 CTTGAAAAAAAGGCGGGGGCTGG - Intronic
943729649 2:191288258-191288280 GAAGAAAGAAAGGTGGTGGCTGG + Intronic
946290844 2:218743973-218743995 TTAAAAACAAAGATAGAGGCCGG - Intronic
947470077 2:230393248-230393270 CTAGAAGCACAGGTGAAGACAGG + Intronic
948015227 2:234683637-234683659 TTAAAAATAAAGGTGGAGTCAGG - Intergenic
948704933 2:239784183-239784205 ATAGAACAAAAGGTGGAGGAAGG - Intronic
1168809153 20:692598-692620 GTAGAAACCAAGGTGTAGGTTGG + Intergenic
1169094357 20:2883354-2883376 TTAGAAAGAAATGTGCAGGCCGG + Intronic
1170005825 20:11667924-11667946 TTAAAAAGAAAGCTGGAGGCCGG - Intergenic
1170116913 20:12870445-12870467 GTAGAAACAAAATTGGAAGCCGG + Intergenic
1170370591 20:15643919-15643941 CTAGAAACAGAAGTGATGGCTGG - Intronic
1172879699 20:38191606-38191628 CCAGAGACAATGGTGGAGGTAGG + Intergenic
1174322106 20:49750088-49750110 CTATAATAAAAGGGGGAGGCTGG + Intergenic
1177801119 21:25830010-25830032 GTAGAAAGAAATGTGGAGGTTGG - Intergenic
1177962955 21:27691600-27691622 CTAGAATCACAAGTGGAGGGAGG + Intergenic
1178449898 21:32688535-32688557 TTAAAAATAAAGGTGGAGGGTGG - Intronic
1178883959 21:36470527-36470549 CTTGAAACTAAGGTGTGGGCAGG - Intronic
1179071339 21:38073845-38073867 CTAGAAACAGAAGTGGAGAGTGG + Intronic
1179484434 21:41700717-41700739 ATAGAACGAAAGGTGGAGGAAGG - Intergenic
1179639842 21:42740140-42740162 ATAGAAAGATAGGTAGAGGCTGG + Intronic
1181713184 22:24704482-24704504 CTAGAGAAAAATGTAGAGGCTGG - Intergenic
1181893304 22:26083975-26083997 CTAGGGACAGAGATGGAGGCAGG + Intergenic
1182047223 22:27284830-27284852 CAGACAACAAAGGTGGAGGCAGG - Intergenic
1182343969 22:29646739-29646761 CTTGAATCAAAAGTGTAGGCAGG + Intronic
1182654906 22:31882040-31882062 CCAGCAACAAAGGTGGAGTGGGG + Intronic
1182728814 22:32471132-32471154 ATAGGGACAAAGTTGGAGGCGGG - Intergenic
1182778289 22:32847302-32847324 TTAGAAACAGAGGTGGATGCAGG + Intronic
1183929962 22:41230257-41230279 CTAGAAGCCAGGCTGGAGGCAGG - Exonic
1184369152 22:44071588-44071610 CTAGGAGCATAGGTGGTGGCTGG - Intronic
1184869074 22:47222133-47222155 CATGAAGCAAAGGTGGAGGAGGG - Intergenic
1185079160 22:48700232-48700254 CTAGGAACATAGGAGGGGGCTGG + Intronic
949160286 3:873862-873884 TTAGAAACAAAATGGGAGGCAGG + Intergenic
949585335 3:5431495-5431517 ATAGAACAAAAGGTGGAGGAAGG + Intergenic
949983709 3:9521697-9521719 ATAAAAAAAAAAGTGGAGGCTGG - Intronic
950813763 3:15676120-15676142 CTAATAACAAAGATGGGGGCAGG + Intronic
951715474 3:25639600-25639622 TTAAAAACAAATGTGGAGGCTGG - Intronic
951871988 3:27372051-27372073 CTAAAAACAAAGAAAGAGGCCGG + Intergenic
952006231 3:28845354-28845376 AGAGAAATAAATGTGGAGGCGGG - Intergenic
952906335 3:38141345-38141367 CTACAACGAAAGGAGGAGGCAGG - Exonic
952962000 3:38598177-38598199 CAGGAAACAAAGATGGAGGTGGG + Intronic
954260353 3:49434183-49434205 CTTAAAACCAAGATGGAGGCTGG + Intergenic
955011855 3:55025333-55025355 TAAGATACAAAGGTGAAGGCTGG + Intronic
955021257 3:55123671-55123693 CTAAAGAAAAAGGTCGAGGCAGG + Intergenic
955169082 3:56545635-56545657 GTAGAAATAAAGTTGGGGGCTGG + Intergenic
955485183 3:59427976-59427998 CTAGAGCCAGAGGTGGAGGTGGG + Intergenic
957242151 3:77673356-77673378 CTAGAATCAATGGTAGAGGAAGG + Intergenic
958602406 3:96313377-96313399 TTAGGAACAAAGTTGAAGGCAGG + Intergenic
959132926 3:102380399-102380421 CTAGAAGCAAAAGTGGCAGCTGG + Intronic
959468559 3:106720779-106720801 CCAGCACCCAAGGTGGAGGCAGG - Intergenic
959760351 3:109955760-109955782 CTATAAACAAATGTGGAGAAAGG - Intergenic
959782682 3:110255121-110255143 TTAGAAAAAAAGGTTGAGGGAGG - Intergenic
960707577 3:120495227-120495249 CTATAAACAAAAGTGTAGACTGG + Intergenic
961563534 3:127747357-127747379 CTAGACACACAGGAGAAGGCTGG - Intronic
961675526 3:128563176-128563198 TTAGAAACCAAGGTGGACACGGG - Intergenic
961695628 3:128702293-128702315 CTATAAACAAAGCTGGAGACTGG - Intergenic
961836359 3:129663796-129663818 CTAGAAAAAATGGAGGAGGAGGG + Intronic
961879262 3:130049244-130049266 TTAGAAAAATAAGTGGAGGCTGG + Intergenic
962164937 3:133038672-133038694 CGGGAAACAAAGGCGGAGGCAGG - Intronic
963175071 3:142289696-142289718 CTAAAAAAAAAGGTACAGGCTGG - Intergenic
964200921 3:154118472-154118494 CAAGAAACATAGTTGAAGGCAGG + Intergenic
965193321 3:165560073-165560095 CCAGAAAAATAGGTGGAGGAAGG + Intergenic
965727467 3:171733914-171733936 CAGGAAACAAAGGTGGAGAAAGG + Intronic
966495937 3:180580733-180580755 CTAAAAAGAAGGGTTGAGGCTGG + Intergenic
968991491 4:3916268-3916290 TTAGAAAAATAAGTGGAGGCTGG + Intergenic
969048007 4:4352227-4352249 GTAGAAATAAATGAGGAGGCCGG - Intronic
969049675 4:4363788-4363810 CTAGAAACACAGGTGACGCCGGG - Intronic
969482857 4:7456001-7456023 CTTGAGACCAAGGTGTAGGCAGG + Intronic
970669597 4:18380691-18380713 CTAGAGAGTAAGGTGGGGGCTGG + Intergenic
973535314 4:51875960-51875982 CTAGAAACAAAAGTGGATACCGG - Intronic
974379506 4:61120312-61120334 TCAGAAAAAAAGGTGTAGGCAGG - Intergenic
974446701 4:61993585-61993607 GTAGAAACAATGAAGGAGGCTGG - Intronic
975318770 4:72985346-72985368 AAAGAAACACAGGTGGAGGATGG - Intergenic
975569063 4:75793439-75793461 AAAGAAATACAGGTGGAGGCTGG - Intronic
977380462 4:96266736-96266758 TTACAAACAAGGGTTGAGGCCGG - Intergenic
979834088 4:125339490-125339512 ATAGAAATAATGTTGGAGGCTGG - Intronic
979960576 4:127015935-127015957 AAAGAAACAAAGGTGCTGGCAGG + Intergenic
981486660 4:145294133-145294155 GAAGATACAAAAGTGGAGGCAGG + Intergenic
981850734 4:149227237-149227259 AGGGAAACAAAGGTGGAGGTGGG - Intergenic
981866424 4:149425574-149425596 ATAGAAAAAAAGGTGGAGGAAGG - Intergenic
982024137 4:151235044-151235066 CTAAAATAAAAGTTGGAGGCTGG - Intronic
982049808 4:151489497-151489519 CTACAGCCAAAGGTGCAGGCAGG + Intronic
982744727 4:159094763-159094785 CTAGAAAAAAAAATGCAGGCCGG - Intergenic
982744750 4:159094895-159094917 CTAGAAAAAAAAATGCAGGCCGG - Intergenic
983569156 4:169185877-169185899 CAAGAATCAAATGGGGAGGCAGG + Intronic
983987939 4:174082586-174082608 GGAGCAACAAAGGTGGAGGGAGG + Intergenic
984594214 4:181649114-181649136 CTAGAAATGGAGGTGGGGGCAGG - Intergenic
984636677 4:182118584-182118606 CTACAAAAAAAGGTGGAGGGGGG - Intergenic
986439400 5:7766181-7766203 ATAGATACAAATGTCGAGGCTGG + Intronic
987192590 5:15493482-15493504 CAAGAAACAAATGAGGAGTCTGG - Intergenic
987811743 5:22845695-22845717 CATGAAACAAAGGGGGATGCTGG + Intronic
988507107 5:31833170-31833192 CTAGAAACAAAGGTGGAGGCTGG + Intronic
988555207 5:32230547-32230569 CCAGAAACAAATGGGGAAGCAGG + Intronic
991020053 5:61971193-61971215 CTGAAAACAAAGGTGGATGCGGG + Intergenic
991042319 5:62188655-62188677 CCAGAAGCAGAGATGGAGGCTGG - Intergenic
991655523 5:68900250-68900272 CTAGACACAGAGGAGGAGCCAGG - Intergenic
993173452 5:84451637-84451659 TTAGAAACAAAGAATGAGGCTGG + Intergenic
993193796 5:84713691-84713713 CTTGAAACAAAGATTGAGACTGG - Intergenic
994000288 5:94771884-94771906 CTAAAAATGAAGGTGTAGGCAGG + Intronic
994096964 5:95856222-95856244 CAAGAAAAAAAGCTGCAGGCAGG - Intronic
994261394 5:97662987-97663009 CTGGAAACAAAGATGAATGCTGG + Intergenic
994520234 5:100824652-100824674 CTGAAAAAAAAGGTGGAGGGGGG + Intronic
996117552 5:119634628-119634650 CCAGAAGCAAAGGAGGAGGAGGG + Exonic
997021038 5:130002079-130002101 CTATAAACAAAGGTGGTGCTTGG + Intronic
997601419 5:135141228-135141250 CTGGAGACCAAGGTGGAGCCAGG - Intronic
997922083 5:137991037-137991059 CTAGATACAAAAGGGGAGGATGG + Intronic
998047415 5:138999545-138999567 CTAGCTACTGAGGTGGAGGCAGG + Intronic
998087251 5:139336552-139336574 CTAAAAAAAAAGGTGGGGGTGGG - Intergenic
998541273 5:142983500-142983522 ATAGAAACAAAGGACCAGGCTGG - Intronic
999201121 5:149816982-149817004 CTAGAAAGGCTGGTGGAGGCTGG - Intronic
999382493 5:151131350-151131372 ATAGAAACAAAGAGGGAGTCAGG - Intronic
999542850 5:152592571-152592593 CTACAACCAAAGGTGGAAGAAGG + Intergenic
999803655 5:155061589-155061611 ATAGAAAAGAAGGTGGTGGCTGG - Intergenic
999862911 5:155667735-155667757 GTAGTAAACAAGGTGGAGGCTGG - Intergenic
1000168312 5:158677144-158677166 CAACAAACAAAGCTGGAGGCTGG - Intergenic
1001109053 5:168880347-168880369 TTAGAAAGAGAGGTGGAAGCCGG - Intronic
1002658814 5:180775918-180775940 CTAGAAAGAAAGAGGGAGGCAGG + Intergenic
1002790580 6:434768-434790 CTGGACACACAGGTGGAGGGAGG - Intergenic
1003142597 6:3483952-3483974 CGGGAAACAAAGATGGAAGCAGG + Intergenic
1004714722 6:18206217-18206239 GTAAAAACAAAGGAAGAGGCTGG + Intronic
1004891698 6:20107240-20107262 ATAGAATCCAAGGTGGAGGGAGG - Intronic
1005368051 6:25099226-25099248 ATAGTAACATAGTTGGAGGCAGG - Intergenic
1005699607 6:28387119-28387141 TTAAAAATAAATGTGGAGGCTGG - Intronic
1007084008 6:39130074-39130096 CAAGAAATCGAGGTGGAGGCTGG + Intergenic
1007243498 6:40443605-40443627 CAATAAAGAAAGGTGCAGGCAGG - Intronic
1007717874 6:43867748-43867770 CTTGAGGCAAAGGTGGTGGCAGG - Intergenic
1008303019 6:49865799-49865821 CTTGAAACAAGGGTGGAGACTGG + Intronic
1008935378 6:56986690-56986712 CAAGAAAAGAAGGTGGAGGAGGG - Intronic
1009310668 6:62148566-62148588 TTAGGAACAAAATTGGAGGCAGG - Intronic
1009350543 6:62671577-62671599 ATAGAAAAAAAAGTGGAGGAAGG - Intergenic
1009455055 6:63846949-63846971 CTAGAAATAAATGTGAAGCCTGG + Intronic
1010134471 6:72534285-72534307 ATGGAAACAAAGGAGGAGTCAGG + Intergenic
1010205241 6:73316608-73316630 TGGGAAGCAAAGGTGGAGGCGGG + Intergenic
1010658305 6:78538805-78538827 CTGGGAACAAAAATGGAGGCAGG + Intergenic
1011292489 6:85791171-85791193 CTAGAACAAAATGTGGAGGAAGG + Intergenic
1011331120 6:86207633-86207655 CTAGAAGCAAAGATGGATGGTGG + Intergenic
1012827075 6:104160037-104160059 CTAGAAACACAGGTGGCAGAGGG + Intergenic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1015743033 6:136478903-136478925 CCAGAAAAAAAAGTGGAGGAGGG + Intronic
1016269995 6:142277673-142277695 CAAGAAATAATGGTGAAGGCTGG + Intergenic
1016648878 6:146441033-146441055 AGAGAAAGAAAGGTGGAGGCGGG + Intergenic
1017161472 6:151369674-151369696 CTTAAAAAACAGGTGGAGGCTGG + Intronic
1017608462 6:156158347-156158369 CTAGAGACAAAGATGGAGGTAGG + Intergenic
1017641315 6:156496936-156496958 CTAGAAAAAAAACTGGAGGAGGG + Intergenic
1017804199 6:157929212-157929234 CTACAAACAAAGGAGAAGGAGGG - Intronic
1018487564 6:164257420-164257442 CAAGAAGCAGAGGTGGACGCCGG + Intergenic
1019300416 7:300298-300320 CTAGAAACAAAGGAGGCTGTGGG - Intergenic
1020355012 7:7266276-7266298 ATAGAACAAAAGGTGGAGGAAGG + Intergenic
1021103426 7:16609496-16609518 TTAGGAACAAAGGTGGAGATAGG - Intronic
1021257174 7:18406683-18406705 TTAGAAAAAAAGGGGAAGGCCGG - Intronic
1021633474 7:22668436-22668458 CCAGTAACCAAGGGGGAGGCCGG - Intergenic
1022139316 7:27479374-27479396 TCTGAAATAAAGGTGGAGGCGGG + Intergenic
1023819283 7:43971496-43971518 AGAAAAACAAAGATGGAGGCCGG - Intergenic
1023822803 7:43989286-43989308 TTAGAAAGAGAAGTGGAGGCCGG + Intergenic
1024262767 7:47584157-47584179 CTAGAAACAAAGGTGTGGTTGGG - Intergenic
1024677621 7:51651457-51651479 CCAGAAAGAAAGGTGGGGGAAGG - Intergenic
1024813668 7:53243003-53243025 GAAGAAACAAAAGTGGAGGCCGG - Intergenic
1024993416 7:55253880-55253902 CTCGGAAGAAAGATGGAGGCGGG - Intronic
1026835521 7:73636483-73636505 GGAGAAACAAAGGCGGGGGCTGG + Intergenic
1027795651 7:82690691-82690713 CTAGAGAAAAAGGTGGAGGAAGG - Intergenic
1029422930 7:100480638-100480660 CTAAAAAAAAAGGCGGGGGCAGG - Intergenic
1029744336 7:102508461-102508483 AGAAAAACAAAGATGGAGGCCGG - Intronic
1029751067 7:102542701-102542723 TTAGAAAGAGAAGTGGAGGCCGG + Intronic
1029762327 7:102607623-102607645 AGAAAAACAAAGATGGAGGCCGG - Intronic
1029769020 7:102641812-102641834 TTAGAAAGAGAAGTGGAGGCCGG + Intronic
1030063541 7:105641743-105641765 CAAGAAAGAAAGGTAGAGCCTGG - Intronic
1030114698 7:106054403-106054425 AAAGAACCAAAGCTGGAGGCTGG - Intergenic
1031974925 7:128087546-128087568 CTAGAGACAAAGGTGGTGCTGGG + Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1034713840 7:153220941-153220963 CAAGAAAAAAAGGAGGAGGTAGG - Intergenic
1034912621 7:155009695-155009717 CTACTTACAAAGGTGTAGGCAGG - Intergenic
1035179073 7:157076368-157076390 CAAAAAACAAAGATGCAGGCTGG - Intergenic
1035366828 7:158353913-158353935 CCAGAGACAAAGGTGGGGGTGGG + Intronic
1035816343 8:2545173-2545195 CTGGAACCAAAGGTGGATGGGGG + Intergenic
1037061552 8:14516977-14516999 ATAGATACAAGGGTGGAGCCAGG + Intronic
1037138427 8:15491354-15491376 CTAGGAACAAAATGGGAGGCAGG + Intronic
1037384722 8:18326233-18326255 ATAGAACAAAAGGTGGAGGAAGG - Intergenic
1037454730 8:19052094-19052116 ATGGAAGCAAAGGTGGAGGCTGG + Intronic
1037554704 8:20010989-20011011 AAAGAAAGAAAGGTGGAGGCAGG - Intergenic
1037745607 8:21641837-21641859 CTGGGAAGAAAGGTGGAGGCAGG - Intergenic
1038575766 8:28701981-28702003 GTCCAAAAAAAGGTGGAGGCGGG - Intronic
1038913720 8:31996100-31996122 GAAGAAACAAAGGTGGAAGGAGG - Intronic
1039032538 8:33325915-33325937 CTGGAAACACAGGTGGGCGCGGG - Intergenic
1043407229 8:79950086-79950108 CTAGAAACTAGGGGGGAAGCTGG - Intronic
1043706839 8:83360750-83360772 ATAGAACAAAAGGTGGAGGATGG + Intergenic
1044605979 8:94047790-94047812 ATAGAACAAAAGGTGGAGGAAGG + Intergenic
1045178352 8:99751980-99752002 CTAGAAAGAAAAGGGCAGGCAGG - Intronic
1045341517 8:101258843-101258865 GTGGAAACAGATGTGGAGGCAGG - Intergenic
1047451699 8:124970916-124970938 TTACAAGCAAAAGTGGAGGCAGG + Intergenic
1047649185 8:126901205-126901227 CTTTAAAAAAAGATGGAGGCTGG + Intergenic
1048105872 8:131408867-131408889 ATAGAAATATAGGTGGATGCTGG - Intergenic
1048141830 8:131802430-131802452 GTAGGAACAAAGGTGTGGGCTGG + Intergenic
1048452361 8:134544647-134544669 CTAGAAGAAAAGGTGGAGGAGGG + Intronic
1049305690 8:141902678-141902700 CTCGGACCACAGGTGGAGGCCGG - Intergenic
1049473911 8:142788165-142788187 TTAGAAACCAGGGTGCAGGCGGG + Intergenic
1050538527 9:6650381-6650403 GGAGGAACAAAAGTGGAGGCAGG - Intergenic
1052769291 9:32672730-32672752 GCAGAAACAAAGGTAGAGGAAGG - Intergenic
1056128296 9:83558884-83558906 CTAGAATCAGAAGTGGAGCCTGG + Intergenic
1057016533 9:91657435-91657457 TTAGAAAGGAAGGAGGAGGCTGG - Intronic
1057397124 9:94690111-94690133 CCTGAAACAAAGGTGTTGGCAGG - Intergenic
1057771364 9:97970984-97971006 CTAAAAAGAAACCTGGAGGCCGG + Intergenic
1058974397 9:110112673-110112695 GTAGATACAAAGGTGGAAACTGG - Intronic
1059568100 9:115404047-115404069 ATAGAAAGAAGGGTGGAGGAGGG - Intergenic
1061310395 9:129758386-129758408 ATGGAAAGAAAAGTGGAGGCAGG - Intergenic
1186443122 X:9603294-9603316 CTAAAAACAAAGGTGGTGGGTGG - Intronic
1186766154 X:12772507-12772529 TTAGAAACACAAGTGAAGGCAGG - Intergenic
1186790805 X:12996556-12996578 ATAAAATCAAAGGTGGAGGCAGG - Intergenic
1186981116 X:14958584-14958606 CCAGGAAAAAAGGTGGAGGCAGG + Intergenic
1188432567 X:30121395-30121417 CTAGAAATAAATGTGGGGGTAGG - Intergenic
1190026558 X:46929093-46929115 CTAGAAACCAAACTGGAGCCAGG - Intronic
1190765780 X:53474559-53474581 TTAGAAACTAAGTTGGAAGCTGG + Intergenic
1191893673 X:65971023-65971045 CTAGAATCTAAACTGGAGGCTGG - Intergenic
1192085065 X:68087833-68087855 CTAGAAACAAAGGTGGCAAAGGG + Intronic
1192192239 X:68998150-68998172 CAAGAAGCAAGGGTGGAGGGGGG + Intergenic
1192370999 X:70512882-70512904 CTAGAATAAGAGGTGGAGGAAGG - Intergenic
1193819982 X:86149176-86149198 CTACAAACAAAGTTGGATGAGGG - Intronic
1194496151 X:94620141-94620163 GAAGAAGCAAAAGTGGAGGCCGG + Intergenic
1198213354 X:134535178-134535200 CTTGAAAGATAAGTGGAGGCCGG + Intergenic
1199079923 X:143565628-143565650 AAAGGAACAAAGCTGGAGGCAGG + Intergenic
1199133293 X:144220144-144220166 ATAGAGACAAAGGAAGAGGCAGG - Intergenic
1199493213 X:148424106-148424128 ATAGAACAAAAGGTGGAGGATGG - Intergenic
1200292803 X:154887819-154887841 TATGAAACAAAGGCGGAGGCAGG - Exonic
1200339649 X:155383559-155383581 TATGAAACAAAGGCGGAGGCAGG - Intergenic
1200346821 X:155457134-155457156 TATGAAACAAAGGCGGAGGCAGG + Exonic