ID: 988508594

View in Genome Browser
Species Human (GRCh38)
Location 5:31846089-31846111
Sequence AACCCAAAGCCACCACAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 237}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988508594_988508597 -2 Left 988508594 5:31846089-31846111 CCCCTCTGTGGTGGCTTTGGGTT 0: 1
1: 0
2: 1
3: 29
4: 237
Right 988508597 5:31846110-31846132 TTTGAAGCATTTTGTTTGTTTGG 0: 1
1: 1
2: 6
3: 64
4: 680
988508594_988508598 2 Left 988508594 5:31846089-31846111 CCCCTCTGTGGTGGCTTTGGGTT 0: 1
1: 0
2: 1
3: 29
4: 237
Right 988508598 5:31846114-31846136 AAGCATTTTGTTTGTTTGGTTGG 0: 1
1: 1
2: 21
3: 143
4: 790
988508594_988508599 6 Left 988508594 5:31846089-31846111 CCCCTCTGTGGTGGCTTTGGGTT 0: 1
1: 0
2: 1
3: 29
4: 237
Right 988508599 5:31846118-31846140 ATTTTGTTTGTTTGGTTGGTTGG 0: 4
1: 130
2: 406
3: 1201
4: 3017
988508594_988508600 24 Left 988508594 5:31846089-31846111 CCCCTCTGTGGTGGCTTTGGGTT 0: 1
1: 0
2: 1
3: 29
4: 237
Right 988508600 5:31846136-31846158 GTTGGTTTTTTTCTTTGAGACGG 0: 1
1: 13
2: 374
3: 6653
4: 117483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988508594 Original CRISPR AACCCAAAGCCACCACAGAG GGG (reversed) Intronic
900079218 1:843018-843040 ACCCCACAGCCACTACTGAGAGG + Intergenic
900390973 1:2433775-2433797 CACCCAAAGCCACGAAGGAGCGG - Intronic
900666872 1:3821478-3821500 AACCTAGGGTCACCACAGAGTGG + Intronic
902119460 1:14149664-14149686 AACCCACAGTCACCACAAGGAGG - Intergenic
902740850 1:18436964-18436986 ATCCCAAGCCCACCATAGAGAGG + Intergenic
902803294 1:18844827-18844849 ACCCCAAGGCCTGCACAGAGTGG + Intronic
908862190 1:68501730-68501752 AACCCAAACCCAGCAGAGAAAGG + Intergenic
910112938 1:83701510-83701532 AACAAAAAGCAACCACAGACTGG - Intergenic
912619509 1:111140537-111140559 ACCCCAATGTCTCCACAGAGGGG - Intronic
913401196 1:118435415-118435437 AACCCAAGGCTATCACAGTGTGG - Intergenic
916921430 1:169471879-169471901 ATCCCAAAGCAACCCCAGTGTGG + Intronic
917317492 1:173740769-173740791 AAGCCAAAGCCACGGCAGACAGG - Intronic
917650793 1:177075504-177075526 AAACCAAAGACAACACAAAGTGG - Intronic
917802821 1:178585620-178585642 AAGCCAAAGCCAGCAAAGATAGG - Intergenic
919077718 1:192832902-192832924 AAAACAAAGCCTCCACAGTGTGG - Intergenic
921994697 1:221405475-221405497 AACCCAAAGCCAACAGAAAAAGG - Intergenic
922064268 1:222121489-222121511 CAACCAAAGACACCACAGAAAGG + Intergenic
1063501636 10:6560388-6560410 AAACCAAAAACAGCACAGAGGGG - Intronic
1065455896 10:25906341-25906363 AGCTAAAAGCCCCCACAGAGGGG + Intergenic
1067036819 10:42926972-42926994 ATGCGAAAGCTACCACAGAGCGG - Intergenic
1069933587 10:71900135-71900157 ACCCCACAGCCACCACAGCTGGG + Intergenic
1070140998 10:73737732-73737754 AAAACAAAGCCTCCACAGTGTGG - Intergenic
1071153707 10:82665795-82665817 AAAGAAAAGTCACCACAGAGAGG - Intronic
1071335560 10:84597529-84597551 ACCCAAAAGCTACCACAAAGGGG - Intergenic
1072574457 10:96687450-96687472 AACCCAAAATCACTGCAGAGTGG - Intronic
1076719432 10:132386806-132386828 ATCCCAAATCCACCAGGGAGAGG - Intergenic
1076719510 10:132387046-132387068 ACCCCAAATCCACCAGAGAGGGG - Intergenic
1076719525 10:132387087-132387109 ACCCCAAATCCACCAGGGAGAGG - Intergenic
1076719540 10:132387128-132387150 ACCCCAAATCCACCAGATAGAGG - Intergenic
1076719575 10:132387248-132387270 ACCCCAAAGCCACCAGGGAGGGG - Intergenic
1076719591 10:132387289-132387311 ACCCCAAATCCACCAGGGAGAGG - Intergenic
1076719642 10:132387453-132387475 ACCCCAAATCCACCAGGGAGAGG - Intergenic
1076719656 10:132387494-132387516 GCCCCAAATCCACCAGAGAGAGG - Intergenic
1076719667 10:132387535-132387557 ACCCCAAATCCACCAGAGAGAGG - Intergenic
1076719679 10:132387576-132387598 ACCCCAAATCCACCAGAGAGAGG - Intergenic
1076803177 10:132841985-132842007 CACCAAAAGTCAGCACAGAGAGG - Intronic
1078869272 11:15328623-15328645 ATCCCAAAGCCAGCCCAGACAGG + Intergenic
1080896454 11:36452457-36452479 TAACCACAGCCACCACAGATCGG + Intronic
1081543443 11:44052682-44052704 AAGGCAAAGCCACCATAGAAGGG - Exonic
1082991169 11:59208218-59208240 AACCCAAATCCCTCACAGATAGG - Exonic
1083587648 11:63872180-63872202 AGCCCAAGGCTGCCACAGAGAGG - Intronic
1083798321 11:65031538-65031560 AACCCCAAGCCTCCAAAGAAGGG - Intronic
1083873535 11:65507347-65507369 AACCCAGACCTACCAGAGAGAGG + Intergenic
1088722057 11:112601645-112601667 AGCCCAAAGCCAGCATAAAGGGG - Intergenic
1089162801 11:116452436-116452458 AACACAAAGCCTACACACAGGGG + Intergenic
1089466486 11:118689532-118689554 AGCCCACAGCCCCCACTGAGAGG - Intergenic
1089608518 11:119656257-119656279 AGCCCAGAGCTAGCACAGAGTGG - Intronic
1089700709 11:120242177-120242199 AACCCTCAGACACTACAGAGGGG - Intronic
1091439047 12:498371-498393 CATCCAAAGCCAGCACACAGTGG - Intronic
1091678707 12:2510756-2510778 ACTCCAAACCCACCCCAGAGGGG + Intronic
1094020669 12:25910384-25910406 ATTCCAAAGCCACTACAGTGAGG - Intergenic
1095257425 12:40055034-40055056 AAACCAAAACAACCACAGCGAGG - Intronic
1096475766 12:51907772-51907794 ACCCCAGAGTCACCGCAGAGTGG + Intronic
1096970680 12:55663992-55664014 ATCCCAAAGCCACCCCTGTGGGG + Intergenic
1097305721 12:58067010-58067032 AGTTCAAAGCCACCCCAGAGTGG - Intergenic
1097849078 12:64393886-64393908 AACCCAAATGCACCAAAGATAGG + Intergenic
1099784558 12:87244310-87244332 AAGCCAAAGAGACCACAGAGGGG - Intergenic
1100325965 12:93540183-93540205 TCCCCAAACCCACCACAAAGAGG + Intergenic
1100394107 12:94169783-94169805 TACCCACACACACCACAGAGAGG + Intronic
1101653553 12:106698935-106698957 AACCCAAAGCAAGCACAAAAAGG - Intronic
1102237581 12:111303949-111303971 AACCCAGAACCTCCTCAGAGGGG + Intronic
1102316003 12:111888193-111888215 CACTCAAAGCCACTACTGAGGGG - Intronic
1103412389 12:120721680-120721702 AATCCAAGGCCAGCACACAGGGG - Exonic
1103507985 12:121454278-121454300 AAACCAGAGCCACCCCAGGGAGG + Intronic
1104311151 12:127655271-127655293 AAGCCCAAGCCAGCACAGAGGGG - Intergenic
1104970850 12:132529976-132529998 CACCCACAGCCACCTCTGAGGGG - Intronic
1106227197 13:27794285-27794307 AAGCCCAAGCCAGCCCAGAGAGG - Exonic
1106616836 13:31338311-31338333 AAGCCAAAGCCACCACCCAATGG + Intergenic
1106937528 13:34739583-34739605 AGCCCAAAGCCACTAAAGTGGGG - Intergenic
1108246301 13:48517755-48517777 AACCCGAAGAAACCCCAGAGAGG + Intronic
1108276604 13:48816853-48816875 AACACAAAGCAACCACAGGCAGG + Intergenic
1108562240 13:51656093-51656115 AACCCAAAGCCAGCAAAGGAAGG - Intronic
1110184200 13:72654630-72654652 AACCCAATCCCACCTCAGTGGGG + Intergenic
1110372902 13:74759285-74759307 AACCCATACCCACTGCAGAGGGG - Intergenic
1111957520 13:94775121-94775143 ACCCCAAACCCACAACAGAGGGG - Intergenic
1112565549 13:100548805-100548827 AAGGCAAAGCCACAACAGGGTGG + Intronic
1115535881 14:34372925-34372947 TACCAAAGGCCAACACAGAGAGG - Intronic
1115977852 14:39016888-39016910 ATCCCAGAGCCAACACAGTGGGG + Intergenic
1117816864 14:59607565-59607587 AACCCACAGCAACCACAGCTTGG - Intronic
1119716757 14:76865056-76865078 AATCCAATACCACCACACAGAGG - Intronic
1119874863 14:78050128-78050150 AACCCAAGACCACCACAGATTGG - Intergenic
1120299056 14:82682093-82682115 TTCCCAAAGAAACCACAGAGGGG + Intergenic
1121367343 14:93326054-93326076 AACAAAAAACCACCACAGCGTGG + Intronic
1121989541 14:98542436-98542458 ACCCCAGAGCCAACACAAAGAGG + Intergenic
1122392635 14:101400521-101400543 TACCCACACCCACCAAAGAGAGG + Intergenic
1123711064 15:22988018-22988040 AACATCAAGGCACCACAGAGTGG - Intronic
1123873454 15:24599196-24599218 AACCCAAAGCCTCCTCACAGGGG + Intergenic
1124158873 15:27251804-27251826 AAAACAAAGCCAGGACAGAGGGG + Intronic
1124617190 15:31250200-31250222 AGCCCAAAGGCTACACAGAGGGG - Intergenic
1124779361 15:32615506-32615528 CACCCAGAGCCACCACGGGGGGG - Exonic
1125567168 15:40685525-40685547 TACCCATAGCCACCACAGCTGGG + Intergenic
1127371844 15:58348920-58348942 AAGCCAAAGCCACAGAAGAGCGG + Intronic
1127546994 15:60001218-60001240 AACCCAAAGCAAACACGGGGTGG - Intergenic
1128836245 15:70811244-70811266 CACACACAGCCAACACAGAGCGG + Intergenic
1128946545 15:71826673-71826695 AAACCAAAGAGACCCCAGAGGGG - Exonic
1129537985 15:76329804-76329826 AACCCATAGCCACCCCAGGCAGG - Intergenic
1130378743 15:83354097-83354119 AACACAAGGACACAACAGAGGGG - Intergenic
1130583599 15:85160958-85160980 AACCAAAAGCTAACACAAAGAGG + Intergenic
1132116935 15:99144258-99144280 AGCGCAAAGCCACCACAGCTAGG - Intronic
1133576992 16:7101525-7101547 AACCAAAAGCATTCACAGAGAGG + Intronic
1134805763 16:17123281-17123303 AACCCAAACCCACCAAGGAGAGG - Intronic
1139440611 16:66964774-66964796 ACCCCAGGGCCAGCACAGAGTGG - Intronic
1140102395 16:71928854-71928876 ATCCCAAAGCCACCCCTGTGGGG - Exonic
1141915873 16:87096682-87096704 ATCCCAAAGACACCGCTGAGGGG + Intronic
1142420645 16:89967422-89967444 TGCCTAAAGCCACCACAGTGGGG - Exonic
1143261797 17:5605031-5605053 AAGCCAATGAAACCACAGAGAGG - Intronic
1144088236 17:11830030-11830052 AACCCAAGTCCACCACAGAGAGG - Intronic
1145166333 17:20615471-20615493 TGCCTAAAGCCACCACAGTGGGG - Intergenic
1147382568 17:40063961-40063983 GAGCCAAAGCCAGCACTGAGGGG - Intronic
1147390112 17:40103885-40103907 GACCCAAAGCCACCAAAGGGAGG + Intergenic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1151807436 17:76414846-76414868 AGCCCAGAGCCAAGACAGAGGGG - Intronic
1152244709 17:79179259-79179281 AACCCAAAGGCTCCGCCGAGGGG - Intronic
1152495855 17:80670924-80670946 AACCCAGCTCCACCACAGAGAGG - Intronic
1155226811 18:23736699-23736721 AACCCAAATACTACACAGAGAGG - Intronic
1157103837 18:44754872-44754894 TACCCAAAGCCCCAACATAGTGG + Intronic
1157311921 18:46559406-46559428 AACCCACAGCCCCCACCCAGGGG + Intronic
1157816038 18:50729938-50729960 AACCCCAAGGCAGCAGAGAGGGG - Exonic
1159339686 18:67119076-67119098 TACCCATAGCCACCACAGCTGGG + Intergenic
1159711607 18:71766409-71766431 AAGCCAAAGGCAATACAGAGTGG + Intronic
1160278388 18:77461670-77461692 AAAACAAAGCCAACACAGTGAGG - Intergenic
1160827683 19:1088414-1088436 ACCCCAAACCCCCAACAGAGGGG + Exonic
1162520358 19:11175908-11175930 ATCCCAACGCCCTCACAGAGCGG - Exonic
1163377539 19:16942709-16942731 AAACCCAAGCCACGGCAGAGGGG - Intronic
1163453393 19:17392083-17392105 AACCCTAAGCCACCAGAAAGTGG + Intergenic
1163608778 19:18290547-18290569 AAACCGAAGCCTCCCCAGAGAGG - Intergenic
1165127531 19:33610805-33610827 CTCCCAATGCCACCACATAGAGG + Intergenic
1165683081 19:37793909-37793931 ATCCCAAAGCCACCCCTGTGGGG - Intronic
1167243936 19:48362771-48362793 TACCCAAGGCCACAACATAGTGG - Intronic
925463916 2:4089330-4089352 AACACAAAGCCACTGGAGAGAGG + Intergenic
926419521 2:12682804-12682826 AGCCCAAAGCCAGCTGAGAGGGG - Intergenic
926424392 2:12727934-12727956 ACCCCAATGCCACAGCAGAGAGG - Intronic
927413338 2:22851467-22851489 AACCCAAAGCCGGCACAGTCAGG + Intergenic
928424695 2:31168430-31168452 AACCCAAAGCCACTTGAAAGAGG + Intergenic
930770697 2:55127902-55127924 AAAAAAAAGCCATCACAGAGAGG - Intergenic
931859687 2:66341854-66341876 GACCCAAAGTCATCACACAGAGG + Intergenic
932816126 2:74863735-74863757 AACCCAGAGTCACCCCATAGAGG + Intronic
934911480 2:98259763-98259785 AACCCAAAGCCAGCAGAGGAAGG - Intronic
936270832 2:111047291-111047313 AACACAGGGTCACCACAGAGAGG + Intronic
936622385 2:114113795-114113817 AAACCAAAGCCATCACTGAGGGG + Intergenic
937109763 2:119355596-119355618 AATCTAATGCCACCACTGAGAGG - Intronic
938177126 2:129144169-129144191 AACACAAACCTTCCACAGAGTGG + Intergenic
938725735 2:134107533-134107555 AAACCAAACCCAGCTCAGAGTGG - Intergenic
942352308 2:175065488-175065510 ACCCCATAGCCACCACAGCTGGG - Intergenic
943923303 2:193738414-193738436 ACCCCATAGCCACCACAGTTGGG - Intergenic
944692638 2:202171595-202171617 CATCACAAGCCACCACAGAGAGG - Intronic
947318981 2:228896015-228896037 CACCAAAAGGCAACACAGAGGGG - Intronic
948027988 2:234793043-234793065 AACCCAAAGCCACCATTTAGTGG - Intergenic
948159026 2:235809085-235809107 CACCCAAATCAACCACAGACAGG - Intronic
948299335 2:236890200-236890222 AACCCAAAGCCAGCACTGTGAGG - Intergenic
948337224 2:237218932-237218954 AACCTAAAGCCAACACATATAGG - Intergenic
948361945 2:237428078-237428100 GAACCAAAGCCACCCCAGAATGG - Intergenic
1169075941 20:2759852-2759874 TGCCCAAAGCCCCCACAGGGAGG - Exonic
1170564792 20:17592686-17592708 ATATCAAAGCCACCACAGTGGGG + Intronic
1173098926 20:40065428-40065450 AACCCATAGTCACCAAAGATGGG - Intergenic
1173770921 20:45656744-45656766 AAACCAAACCCATCAAAGAGTGG + Intronic
1174593977 20:51668554-51668576 AACCCCAAATCACCACACAGAGG + Intronic
1177166517 21:17611425-17611447 AACCAAAAGCAACCACTAAGTGG - Intronic
1177868378 21:26540252-26540274 AACCCAAAGCCACCATAAATTGG + Intronic
1178505635 21:33160753-33160775 AACCAAAAGGCACCACTCAGTGG + Intergenic
1179873992 21:44258343-44258365 TACCCAAAGCCACCATCGAGTGG + Intronic
1180205589 21:46257516-46257538 GACCCACAGCCACCACTGATAGG + Intronic
1183091744 22:35526972-35526994 GACCCAAGGCCAGCAAAGAGTGG - Intergenic
1183932867 22:41246162-41246184 AACCCAATCACAACACAGAGGGG + Exonic
1184876953 22:47282299-47282321 GAGCCAAAGCCTCCACAGAGAGG - Intergenic
949273517 3:2249754-2249776 AAACTAAAGCCACCACATAATGG - Intronic
950400413 3:12765518-12765540 AACCCAAAGCAACCATTTAGTGG - Intronic
951038701 3:17964267-17964289 AACCCTAACCCACCACTTAGTGG - Intronic
951910859 3:27749000-27749022 AACCCTAACCCACCCTAGAGAGG - Intergenic
953573196 3:44089400-44089422 AACCCAAAGCAAGCAAAGAAAGG - Intergenic
955032403 3:55233770-55233792 GAGCCACAGGCACCACAGAGAGG - Intergenic
955735782 3:62036867-62036889 ATCCCACAGCCACAACAAAGAGG - Intronic
956394374 3:68809820-68809842 AACACAATGCCAACACACAGTGG - Intronic
956787198 3:72652513-72652535 AGCTCTAAGCCACCAAAGAGAGG + Intergenic
961906084 3:130264315-130264337 GACCCAAGGCCAGCACAAAGAGG - Intergenic
965139939 3:164819300-164819322 AAAACAAAGCTTCCACAGAGTGG - Intergenic
965146420 3:164911584-164911606 AATCCACACCCACCACAGAATGG + Intergenic
965548436 3:169938879-169938901 AACCCAATGAAACCACAGAGAGG + Exonic
966544305 3:181127834-181127856 AACCCAAAGCCAACATGGATGGG - Intergenic
968875077 4:3262388-3262410 AGCGCAAAGCCAGCACACAGAGG - Intronic
969333362 4:6492743-6492765 AACTAAGAGACACCACAGAGAGG + Intronic
969442860 4:7227599-7227621 CACCCCAGGCCACCACACAGAGG - Intronic
971515153 4:27476255-27476277 AACACAAAGCCCCCTCAGGGAGG + Intergenic
972099906 4:35401929-35401951 AACCAAAAGCCAAAACTGAGTGG + Intergenic
973348547 4:49082973-49082995 TCCCCATAGCCACCACAGATGGG - Intergenic
973910934 4:55579675-55579697 AACCAAAAGCCACCAGTGAATGG - Intronic
976990673 4:91361063-91361085 AAACCAAAGTTATCACAGAGGGG + Intronic
978654357 4:111048939-111048961 GCCCCATAGCCACCACAGCGGGG - Intergenic
981298125 4:143156344-143156366 AACCCATAACCACCACAGCTGGG + Intergenic
981453743 4:144929707-144929729 AACCCACAGCCACCACTGAATGG - Intergenic
981721933 4:147810694-147810716 TACCCTAAGGCACTACAGAGAGG - Intronic
982661021 4:158207155-158207177 AACCCAAAGACAACAAATAGGGG - Intronic
985642334 5:1069483-1069505 AACCCACAGCAAGGACAGAGGGG + Intronic
988508594 5:31846089-31846111 AACCCAAAGCCACCACAGAGGGG - Intronic
989113209 5:37927256-37927278 AAGCCAAACCCAGCAGAGAGTGG + Intergenic
991497598 5:67242709-67242731 AACCCAAAGCATCCCAAGAGGGG + Intergenic
994991653 5:107004491-107004513 AACCCAAAGTCTCCAGGGAGAGG + Intergenic
997461459 5:134055258-134055280 ACCCCATAGCCACCACAGCGGGG - Intergenic
998415212 5:141941133-141941155 AATCCAAAATGACCACAGAGGGG - Exonic
1000249478 5:159480363-159480385 TACCCAACTCCTCCACAGAGAGG - Intergenic
1000360138 5:160439360-160439382 CAGCCAAAGCCACCACGGAGGGG - Intergenic
1001400375 5:171442767-171442789 AACCCAAAGTCTTCACAGCGAGG + Intronic
1002119670 5:176992815-176992837 AACAAAAAGCCACCATAGAATGG + Intronic
1004497658 6:16180286-16180308 ACCACAAAGCTACCACAGAACGG + Intergenic
1004860420 6:19799201-19799223 AACCCAAAGAAAGCAGAGAGAGG + Intergenic
1006640111 6:35485489-35485511 AACCCAAGGCCTCCCCAGAATGG + Intronic
1007744776 6:44036779-44036801 AACCCAATGCCAACACACATGGG + Intergenic
1008980350 6:57476062-57476084 CACCCAAAGCGACATCAGAGAGG - Intronic
1013459285 6:110359213-110359235 AACCCAAACCCACCCCAAATGGG - Intergenic
1013567243 6:111379289-111379311 AACCCAAAGCCATCACTGAAAGG - Intronic
1013963284 6:115927394-115927416 AGAACAAAGCCACCACAGTGTGG + Intergenic
1018960239 6:168442193-168442215 AACCCAGAGGCCCCGCAGAGCGG - Intronic
1023711312 7:42996129-42996151 ACCCCAAAGCCACCTCATACAGG + Intergenic
1023905780 7:44520877-44520899 AGCCCACAGCCACCCCAGAGAGG + Intronic
1024133845 7:46386645-46386667 AACACTAAGCCACCACCAAGGGG - Intergenic
1024283579 7:47738555-47738577 AGCCATAAGACACCACAGAGGGG - Intronic
1026289964 7:68997410-68997432 AACCCAAAGCCATCACTTACCGG + Intergenic
1026949999 7:74340689-74340711 AGCCCAAGGCCACCACAGCCTGG - Intronic
1029410401 7:100406131-100406153 AACCCAAAGTGACTACAGGGAGG + Intronic
1033137298 7:138796152-138796174 AACTCAAGGTCCCCACAGAGAGG - Intronic
1033564272 7:142563388-142563410 AACACCAAGCCACCAGTGAGAGG + Intergenic
1034388510 7:150762621-150762643 AACCCAAAGCAAGCAGAAAGGGG + Intergenic
1035184670 7:157116994-157117016 AAACCAAAGCCAGCCCAGAAGGG - Intergenic
1035526415 8:316665-316687 ACCCCACAGCCACTACTGAGAGG - Intergenic
1036936228 8:13004738-13004760 GCCCCATAGCCACCACAGATGGG - Intronic
1039792594 8:40887696-40887718 AACCCAGAGACACGGCAGAGGGG + Intronic
1039880031 8:41619681-41619703 AACCTAAATGCCCCACAGAGTGG - Intronic
1040834576 8:51718770-51718792 TACCCTAATACACCACAGAGGGG - Intronic
1042221693 8:66480623-66480645 CACTCAAAGCCATCACAGCGAGG + Intronic
1043760574 8:84063021-84063043 ACCCCATAGCCACCACAGCTGGG + Intergenic
1043760589 8:84063171-84063193 ACCCCATAGCCACCACAGCTGGG + Intergenic
1044634738 8:94311014-94311036 AACCAAAAGACACCACATATGGG + Intergenic
1044701256 8:94967284-94967306 AATGCAAGGCCAACACAGAGGGG - Intronic
1044992958 8:97812730-97812752 AACCCAAGACAACCTCAGAGTGG + Intronic
1045407247 8:101879543-101879565 AACACAAAACCACCACTGTGTGG + Intronic
1045574954 8:103410415-103410437 AACCCAATGCCACCACTGATCGG - Intronic
1046410374 8:113834021-113834043 AAGCTGAAGCCACCACAAAGTGG - Intergenic
1047151699 8:122271401-122271423 AACACAAAGCCAGGGCAGAGTGG + Intergenic
1048018895 8:130520302-130520324 CACCCCAAGCCAAAACAGAGGGG - Intergenic
1048199057 8:132356472-132356494 GACCTCAAGCCTCCACAGAGTGG + Intronic
1049060283 8:140271393-140271415 CATCCAAAGCCACCACTAAGAGG + Intronic
1049087487 8:140489944-140489966 AAAACAAAGCCTCCACAGTGTGG + Intergenic
1051152470 9:14098296-14098318 AACGCAAAGCCACAAGTGAGTGG - Intronic
1051314618 9:15815244-15815266 AACCCAAAGCAGCTACAGAAAGG - Intronic
1051704320 9:19860512-19860534 GACCCATAGCCACCACAGCTGGG - Intergenic
1052247291 9:26351320-26351342 AACCCACAGCCAACACAAATGGG + Intergenic
1052349926 9:27448016-27448038 GAGACAAAACCACCACAGAGAGG - Intronic
1052726506 9:32234273-32234295 AACCCAAAGCAAACATAAAGAGG + Intergenic
1055652849 9:78423790-78423812 AACAAAATGCCACCACATAGAGG + Intergenic
1056231146 9:84545770-84545792 AAACCAAATCCCCCACACAGTGG + Intergenic
1056438311 9:86594976-86594998 AACCCAGCGTCATCACAGAGTGG - Intergenic
1056769788 9:89468696-89468718 AACCCGCAGCCACCACTTAGAGG - Intronic
1056893056 9:90514054-90514076 AACCCAAAGCCAGCCCAGCCCGG + Intergenic
1057017332 9:91664104-91664126 ATCCCAAAGGCACCAAAGGGTGG + Intronic
1058904383 9:109469824-109469846 AGCCCAATGCCACCACCTAGTGG + Intronic
1060020587 9:120127320-120127342 AACCCAAAGAGCCAACAGAGGGG - Intergenic
1060316894 9:122519872-122519894 AATACAGAGACACCACAGAGAGG - Exonic
1186179222 X:6956791-6956813 AACCAAAAGCCACCATAGAAGGG + Intergenic
1186701579 X:12095867-12095889 AACACTAAGGCACAACAGAGAGG - Intergenic
1189929660 X:45995934-45995956 GACCCATAGCCACCACAGCTGGG + Intergenic
1193185010 X:78501676-78501698 ACCCCATAGCCACCACAGCTGGG - Intergenic
1195275678 X:103277986-103278008 AACCCAGCCCCAGCACAGAGTGG + Intergenic
1196822755 X:119715376-119715398 AACCCAAAGCCATCAAAGGAAGG + Intergenic
1197114728 X:122818546-122818568 AAGCTAAAGCCCCCACAGAGAGG - Intergenic
1197578432 X:128252054-128252076 AACACAAGGCCACCATAGAAGGG + Intergenic
1197876535 X:131114747-131114769 CCCCCATAGCCACCACAGATGGG + Intergenic
1200876070 Y:8155815-8155837 AGGCCACAGCCACCACAGTGGGG + Intergenic
1201057550 Y:10011077-10011099 AGCCCACAGCCACCACAGTGGGG - Intergenic