ID: 988510852

View in Genome Browser
Species Human (GRCh38)
Location 5:31863356-31863378
Sequence CCTGTTAAGCATTAGTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 58}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988510852 Original CRISPR CCTGTTAAGCATTAGTTGGC AGG Intronic
905474523 1:38216690-38216712 CCTGTGGGGCAGTAGTTGGCAGG + Intergenic
907417925 1:54327183-54327205 CCTGTTGAGCATTAGGAAGCGGG - Intronic
908415308 1:63907633-63907655 CCTCTTAAGCATTAGTTCACTGG + Intronic
911046391 1:93632208-93632230 CCTGTTATGCATTATTGGGAAGG + Intronic
912329098 1:108801018-108801040 CCTGTTACACATAAGTTGGAGGG + Intronic
915525680 1:156474961-156474983 CCTGTTAACCATAAGTAGGTGGG + Intronic
1069089925 10:64187907-64187929 CCTGTTATGCTTTGTTTGGCGGG + Intergenic
1071111495 10:82162944-82162966 CCTGTTGGGAACTAGTTGGCAGG + Intronic
1072413225 10:95224741-95224763 CCTATTAAGAATTAGAGGGCAGG - Intronic
1085870640 11:80345581-80345603 CATGTTAAGCATTTGTTGTCTGG - Intergenic
1093043097 12:14407546-14407568 CCTATTAAGCATTATTAGGCTGG + Intronic
1098471900 12:70854812-70854834 CCTGTTAAGCGTTTGTTGTGAGG + Intronic
1107598042 13:41984219-41984241 CTTGTTAACCATTATTCGGCAGG + Intergenic
1110316204 13:74110559-74110581 CCTGTTTTGCATTTGTTGGGAGG - Intronic
1114362159 14:21985924-21985946 CCTCTTAAGCAGTAGAAGGCTGG + Intergenic
1115097191 14:29650653-29650675 CCTTTTAAGCAGTTTTTGGCAGG + Intronic
1118408211 14:65448343-65448365 CCTGATAAGCATGAGTTTGATGG - Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1144951271 17:18994964-18994986 CCTGTCAAGCTTTATTAGGCAGG - Intronic
1151531628 17:74709871-74709893 ACTGTTAAGAATAATTTGGCTGG - Intronic
1155584091 18:27344736-27344758 TGTGTTAAGCAGTATTTGGCAGG - Intergenic
928021662 2:27709972-27709994 CAGGTTAAGCATTTGCTGGCAGG + Intronic
928992990 2:37255462-37255484 CCCGTCAAGAATAAGTTGGCTGG - Intronic
937773995 2:125754100-125754122 CTTGTTAAACATGAGCTGGCAGG - Intergenic
941956940 2:171214564-171214586 CTTGTTAATCATTGGTTGCCAGG + Intronic
1176896993 21:14391406-14391428 CCTTTAAAACAATAGTTGGCCGG - Intergenic
1183578607 22:38708570-38708592 CCTGTTAAGCAGCAGGAGGCAGG + Intronic
952905295 3:38136064-38136086 CTTGTTAACCATTTGTTTGCAGG - Intronic
955961647 3:64346774-64346796 CCTGTTAAGCTTGAGATGTCTGG + Intronic
959776442 3:110169959-110169981 CCTGGTTAGGATAAGTTGGCAGG - Intergenic
965736238 3:171823927-171823949 AATGTTAAGAATAAGTTGGCTGG - Intergenic
967328791 3:188269374-188269396 CCTTTTAAGTATTACCTGGCTGG + Intronic
971026798 4:22597098-22597120 CCCGGTAAACATTAGTTAGCAGG + Intergenic
972511973 4:39775447-39775469 CCTGTTAAGAAACAGTTTGCTGG + Intronic
973102204 4:46287244-46287266 CCTGTTGAAAATCAGTTGGCAGG + Intronic
981192878 4:141884081-141884103 CATGTTATGCATTAATTGGGTGG - Intergenic
983832354 4:172343013-172343035 CCTGTTCAACACTAGTTGGAAGG - Intronic
985151371 4:186950276-186950298 CCTGTTAATCATTACTAGGGAGG + Intergenic
986769948 5:10963497-10963519 CCAGTGAAGCAGTTGTTGGCAGG + Intergenic
988510852 5:31863356-31863378 CCTGTTAAGCATTAGTTGGCAGG + Intronic
990123994 5:52491911-52491933 CCTCTTAAGCATAAATTTGCAGG + Intergenic
998888955 5:146725964-146725986 CTTGTAAAGCATCAGTGGGCTGG + Intronic
1020775042 7:12442641-12442663 CCTGACAAGGATTAGTTGGAAGG + Intergenic
1020842433 7:13235888-13235910 CCTATTTAGCATTAGGTGACTGG - Intergenic
1022042746 7:26595928-26595950 TTTGATAAGCATTTGTTGGCAGG + Intergenic
1026025032 7:66737826-66737848 CCTGTTTAGCAGTAGCAGGCTGG - Intronic
1026124722 7:67569445-67569467 TCTGTTAAGCATGAGTGGGTGGG - Intergenic
1033414702 7:141151740-141151762 CCTGTTAAGACCTATTTGGCAGG - Intronic
1034636026 7:152567870-152567892 CTTGTTAAGAAATCGTTGGCCGG + Intergenic
1037140174 8:15509888-15509910 CCTGGTAAGCATTAGATAACTGG - Intronic
1037383406 8:18312366-18312388 CATGTTTGGCATTAGGTGGCAGG - Intergenic
1040776039 8:51044258-51044280 CCTCTGAAGCATTAGATGCCTGG - Intergenic
1041360346 8:57046400-57046422 CCTGCTAAGCATTGATTGGAAGG + Intergenic
1042978031 8:74492606-74492628 CCTGTGTGGCAATAGTTGGCTGG + Intergenic
1044748699 8:95395790-95395812 CATCTTAAGCAGTAGTTGGATGG - Intergenic
1049517405 8:143068228-143068250 CTTGTTAACAATTTGTTGGCAGG - Intergenic
1052738851 9:32374195-32374217 CCTGTCAAGGATTGGCTGGCTGG - Intergenic
1057071235 9:92102262-92102284 CTTGTTAAGCATTTCTTGTCAGG - Intronic
1060304037 9:122394385-122394407 CCTGTTTCTCCTTAGTTGGCTGG + Exonic
1185773313 X:2782515-2782537 GTTGTTAAGGATAAGTTGGCAGG + Intronic
1192086364 X:68101878-68101900 CCAGTTAACTATTTGTTGGCTGG - Intronic