ID: 988516412

View in Genome Browser
Species Human (GRCh38)
Location 5:31908452-31908474
Sequence AAGATGGTCTGTAGGAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 301}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988516405_988516412 17 Left 988516405 5:31908412-31908434 CCGGGAGATCTCAGACTGGCTGT 0: 1
1: 0
2: 1
3: 34
4: 179
Right 988516412 5:31908452-31908474 AAGATGGTCTGTAGGAGAGAGGG 0: 1
1: 0
2: 3
3: 26
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988516412 Original CRISPR AAGATGGTCTGTAGGAGAGA GGG Intronic
901396429 1:8985454-8985476 AATATGTCCTGTAGGAGGGAAGG + Intergenic
902782720 1:18715057-18715079 AAGATCGCAGGTAGGAGAGACGG + Intronic
903919994 1:26793139-26793161 AAAAGGGTATGCAGGAGAGAGGG - Intronic
903967280 1:27098765-27098787 ACGAGGGTCTTTAGGAGGGAGGG - Intergenic
904028635 1:27520417-27520439 ACAAAGGTCTGAAGGAGAGAAGG - Intergenic
904904071 1:33881349-33881371 AAACTGTTCTGTAGGAGAAAGGG + Intronic
905677417 1:39837384-39837406 AAGATGGTGGGGAGGAAAGATGG - Intergenic
907661460 1:56396593-56396615 CTGTTGGTGTGTAGGAGAGAAGG - Intergenic
907814768 1:57907709-57907731 AAGATGGTGGGGAGGATAGAGGG - Intronic
907872749 1:58457663-58457685 AAGTTTGTCTGTAACAGAGACGG - Intronic
911027565 1:93450277-93450299 AAGATAAACTGTAGAAGAGATGG + Intronic
911216981 1:95205418-95205440 AAGCAGGTTTGAAGGAGAGATGG + Intronic
911378651 1:97084473-97084495 AAGAGGATATGGAGGAGAGAGGG - Intronic
911679267 1:100695505-100695527 AAGATGGCAGGTAGGAGACATGG - Intergenic
912091140 1:106078097-106078119 AAGGTGTTCTGGAGGAAAGATGG + Intergenic
912784327 1:112585226-112585248 GATATTGTCTGTAGAAGAGATGG - Intronic
912902329 1:113665271-113665293 AAGTTGATATATAGGAGAGATGG - Intronic
916425014 1:164671894-164671916 AAGAGGGTCTGGAGAAGAAAGGG - Intronic
917200204 1:172506809-172506831 GAGATGGTCTCTATGAGACATGG + Intergenic
918077402 1:181180981-181181003 AAGGTGGTCTTCGGGAGAGACGG - Intergenic
919633506 1:199982051-199982073 AAGATAGGCTGGTGGAGAGAAGG - Intergenic
920879678 1:209868005-209868027 AGGCTGGGCTGTAGTAGAGAGGG - Intergenic
921324693 1:213979220-213979242 AAGATGGCCTTTAGGAGAAAAGG - Intergenic
923122131 1:231001910-231001932 AAGATGGTGGATAGGAGACAGGG + Intergenic
923304566 1:232676130-232676152 AAGAGTGTCTGCTGGAGAGATGG + Intergenic
923691918 1:236202578-236202600 AAGATGGTGGATAGGAGATAGGG - Intronic
923705709 1:236343025-236343047 AAGATGGTCTGTGGAACAAAGGG - Intergenic
1063403136 10:5767286-5767308 AAGATGATCTGTAGAACAAAGGG - Intronic
1065900827 10:30206491-30206513 GAGATGGTGTGTAGGACAGGTGG + Intergenic
1067247203 10:44557061-44557083 AAGATCATCTGTGGGAGAGAAGG - Intergenic
1068533329 10:58212911-58212933 AATATGGTCAGTAGGACAGAGGG - Intronic
1068779184 10:60901073-60901095 AAGATGGTCTGTGCAATAGAGGG - Intronic
1068933159 10:62612071-62612093 AAGATGGTTTTCTGGAGAGAGGG + Intronic
1069567345 10:69472628-69472650 AAGAGGGTCTGAAGGGGAAATGG + Intronic
1070666853 10:78351075-78351097 AACATGGGCTGTAGGGGAGAAGG - Intergenic
1071342566 10:84662316-84662338 AGGATGGTTGTTAGGAGAGAAGG + Intergenic
1071583462 10:86795510-86795532 AAGTTGCTGTGAAGGAGAGAAGG + Intronic
1071752254 10:88493354-88493376 AAGATGATCTGTATGAGATGGGG - Intronic
1074694825 10:116040731-116040753 AAAATGGTATCTAGGAGTGATGG - Intergenic
1074921751 10:118021415-118021437 CAGCAGGTCTCTAGGAGAGAGGG - Intronic
1075639477 10:124054557-124054579 AAGATGGGATGTAGGAAAAATGG + Intronic
1075845313 10:125540569-125540591 GAGATGGTGTGAAGGAAAGAAGG - Intergenic
1076480415 10:130781598-130781620 AAGATGGTGTTAAGGAGACAGGG - Intergenic
1077925810 11:6681364-6681386 AAGAGGGTCTATGCGAGAGAAGG - Exonic
1077987367 11:7367052-7367074 AAGATGGTCTCCTGGAAAGAAGG - Intronic
1078128616 11:8593789-8593811 AAGATGGGGTGAAGGTGAGACGG + Intronic
1078209863 11:9262224-9262246 AAGATAGTCAATAGGAGAGCAGG + Intronic
1078291370 11:10013373-10013395 AAGCTGGGATGTAGGGGAGAGGG + Intronic
1078991104 11:16647486-16647508 AAGATGGCATATAGGAGACAGGG + Intronic
1080895958 11:36449023-36449045 CAGATGCCCTGCAGGAGAGAGGG - Intronic
1081101235 11:39005720-39005742 AATATGGTCTGTAGAAGGGTAGG - Intergenic
1082041659 11:47690637-47690659 AATATTGGCTGGAGGAGAGAAGG - Exonic
1082048654 11:47752093-47752115 AAGATGGTAGGTAGGATAGTCGG - Intronic
1083631845 11:64099573-64099595 TAGATGGACTGATGGAGAGACGG + Intronic
1084565501 11:69926250-69926272 AAGCTGGTTTCTAGGAGGGAAGG + Intergenic
1084768012 11:71324994-71325016 AAGATGGCCAGCAGGAGCGATGG + Intergenic
1085244590 11:75089628-75089650 AAGAAGGTCTCTGGCAGAGAGGG + Exonic
1086144226 11:83533902-83533924 AAGATAGACTGAAGGAGGGAAGG + Intronic
1087051471 11:93890079-93890101 GAGAGGGTCTGAATGAGAGAGGG - Intergenic
1087757309 11:102068302-102068324 AATCTTGTCTGTAGGAGAAAGGG + Intronic
1088889203 11:114031555-114031577 CAAATGGTCTGTAGGAGAACGGG - Intergenic
1089589665 11:119532341-119532363 AAGCAGGTGTGCAGGAGAGATGG + Intergenic
1089700920 11:120243275-120243297 AAGATGGACACTAGGAGAGAGGG + Intronic
1089725223 11:120471705-120471727 AAGATGGACTGATGGATAGAGGG + Intronic
1091634217 12:2185242-2185264 GAGTTGTTCTGCAGGAGAGAAGG + Intronic
1091712602 12:2752650-2752672 AAGAAGGGCTGCAGGAGAGTCGG + Intergenic
1092217642 12:6694225-6694247 AAAAGGGACTGTAGGAGAAAGGG + Exonic
1092510964 12:9156314-9156336 AAGATGGTCAGTAGGACAAAGGG - Intronic
1092590561 12:9950013-9950035 AAGATGGTCTGAAGCTGAGTTGG + Intergenic
1092784180 12:12012876-12012898 AAGATGGTCTGGAGATGAAAGGG + Intergenic
1092928562 12:13294223-13294245 CAGTTGGCCTGTAGGAGAGTTGG - Intergenic
1092933949 12:13342631-13342653 AAGAAGGTCTGAAGTTGAGAAGG - Intergenic
1094047201 12:26180076-26180098 AAGATGGGTTGTGGAAGAGAAGG - Intronic
1095403296 12:41839746-41839768 AAGCTAGTCTCCAGGAGAGATGG - Intergenic
1095956055 12:47806882-47806904 AAAATGGTCTGTGGTAGAGGAGG - Intronic
1096924720 12:55131135-55131157 ATGATTGTGTGTAGGAGGGATGG - Intergenic
1097703793 12:62846991-62847013 AAGATGATGTCTAGGAGAAAGGG - Intronic
1097998697 12:65918073-65918095 AAGAGGGTCTTTGAGAGAGAGGG - Intronic
1098614824 12:72509167-72509189 AAGATAGGCTGTAGGAGAACAGG - Intronic
1099888085 12:88556381-88556403 AGGATGGACTGGGGGAGAGAGGG + Intronic
1100210288 12:92392306-92392328 CAGATGGTCTGGAGGAGATCTGG - Intergenic
1102158528 12:110749443-110749465 AGAATGGACTGTAGGTGAGAAGG + Intergenic
1102583875 12:113909735-113909757 AAGTGGGTCTGGAGGTGAGAAGG - Intronic
1102633886 12:114305557-114305579 AAGATGGTTAGGGGGAGAGAGGG + Intergenic
1102689110 12:114746615-114746637 AAGAAGGTTGGTAGGAGAGGAGG + Intergenic
1103176162 12:118865394-118865416 AAGAAGGGCTGCAGGAGGGAAGG - Intergenic
1103862190 12:124024319-124024341 AAGATGGTATGAAGAAGAAAGGG - Intronic
1103878104 12:124144635-124144657 AAGTGGGTCTGAAAGAGAGAGGG - Intronic
1106059976 13:26280798-26280820 AAGATGGTGGATAGGAGACAGGG + Intronic
1106588334 13:31076363-31076385 CAGATGGTGTGGAGGGGAGATGG + Intergenic
1107616640 13:42174948-42174970 TTTATGGTCTGTAGTAGAGATGG - Intronic
1107783795 13:43933985-43934007 GAAATGATCTGTATGAGAGAGGG - Intergenic
1107935096 13:45340165-45340187 CAGATGGTCAGTAGGACAGAAGG - Exonic
1108866221 13:54925633-54925655 CACATGGCCAGTAGGAGAGAGGG - Intergenic
1110744148 13:79033010-79033032 AAGTTGGTGAGTAGGACAGAAGG + Intergenic
1114756966 14:25270190-25270212 AAGATGGTGGTTAGGAGACAGGG - Intergenic
1117279654 14:54225974-54225996 AAAATGATCTGGGGGAGAGATGG - Intergenic
1118297602 14:64584988-64585010 AAGAGAGTCTGTAGGAGGGGAGG + Intronic
1118677112 14:68199000-68199022 AGGGTACTCTGTAGGAGAGAGGG - Intronic
1119215348 14:72865095-72865117 AGAATGGTCAGGAGGAGAGAGGG + Intronic
1119651243 14:76384999-76385021 AGCATGGTCTGTAGGTGAGCAGG - Intronic
1120538659 14:85728342-85728364 AATAAGAACTGTAGGAGAGATGG + Intergenic
1121116988 14:91350802-91350824 ATGGTGGTCTGTAGGAGGGAAGG - Intronic
1122076221 14:99236671-99236693 AAGATGGTCTTTAGGAGAGCAGG + Intronic
1126288870 15:47048355-47048377 AGGATAGGCTGTAGGAAAGAAGG + Intergenic
1126673056 15:51134041-51134063 AAGATGGTCTGTTGTAAAGCAGG + Intergenic
1127048771 15:55057478-55057500 AAGCAGGTCTGAGGGAGAGAAGG + Intergenic
1127279681 15:57478261-57478283 AAGATGCTCTGTAGGAGAGGCGG + Intronic
1127839689 15:62820327-62820349 CAGATGGCCTTTATGAGAGACGG + Intronic
1127851217 15:62913553-62913575 ATGAAGGTATGGAGGAGAGATGG + Intergenic
1128295931 15:66519665-66519687 AGGCTGGTCTTTAGTAGAGACGG + Intronic
1128339366 15:66809632-66809654 GAGCTGGTCAGTAGGAGAGAGGG - Intergenic
1128560289 15:68660689-68660711 AAAAAGGTGTGTAGGAGTGAAGG - Intronic
1128591407 15:68900970-68900992 AAGATTCTCAGTAGAAGAGATGG + Intronic
1128604737 15:69028200-69028222 AAGAAGGACTGTGGGCGAGAAGG - Exonic
1130716164 15:86336944-86336966 AAGATTGTCTGAATGAGTGAAGG + Intronic
1131411453 15:92211220-92211242 CAGATGGTCTGGAGGAGATTTGG - Intergenic
1131663458 15:94543825-94543847 AACATAGTCTGCAGGAGAGAAGG - Intergenic
1131836765 15:96398680-96398702 AAGTTGAACTGTAGGAGACAGGG - Intergenic
1133403493 16:5505526-5505548 AAGAGGGGCTGCAGGAGACAGGG - Intergenic
1133833158 16:9342815-9342837 AAGATCTTCAGTGGGAGAGAAGG + Intergenic
1133906857 16:10030321-10030343 AACATGATCTGGAGCAGAGAAGG - Intronic
1135514017 16:23114187-23114209 CAGAAGGTCGGTAGGAGAGATGG + Intronic
1138270697 16:55693880-55693902 AACATGGTCTGAACCAGAGATGG - Intronic
1140708400 16:77653088-77653110 ATGCTGGTCTACAGGAGAGAAGG - Intergenic
1141351028 16:83297015-83297037 AAGATGGAATGAAGGAGAGAGGG + Intronic
1141370213 16:83479766-83479788 AAGTTGGTCATTAGGAGAGAGGG + Intronic
1141889755 16:86918748-86918770 AAGATGGTCTGCAGCAGGGCTGG - Intergenic
1141980427 16:87546942-87546964 AACAAGGACAGTAGGAGAGAGGG - Intergenic
1143836649 17:9698409-9698431 AGGATGCTCTGGAGGACAGATGG - Intronic
1144051179 17:11498386-11498408 AAGATGTCCTTTAAGAGAGAAGG + Intronic
1144285749 17:13772326-13772348 AAGATCACCTGTAGGAGAGTGGG + Intergenic
1144837142 17:18162532-18162554 AAGGTGGACTGTGGGAGAAAGGG - Intronic
1145804582 17:27717424-27717446 CAGATGGTCTGGAGGAGATTTGG - Intergenic
1147884557 17:43675992-43676014 AGGATGGGCTGGAGGAGGGACGG + Intergenic
1148401029 17:47361395-47361417 AAGATTTTCTGTAGGATAAAAGG + Exonic
1148712643 17:49692930-49692952 AACACTGTCTGTGGGAGAGATGG + Intergenic
1149084507 17:52699012-52699034 AAGATGGAGTGTGGGAGAGGAGG - Intergenic
1150602937 17:66666195-66666217 AGGTTTGTCTGTAGGGGAGAAGG - Intronic
1155910903 18:31503592-31503614 AAGATGGGCTTTGGGTGAGATGG + Intronic
1157088546 18:44607706-44607728 AAGATGGTTGGTAGGAAGGAAGG - Intergenic
1157442968 18:47724409-47724431 AAGATGGGGTGTGGGAGTGATGG - Intergenic
1157830251 18:50850919-50850941 AGTATGGTCTGTATGAGAGCAGG + Intergenic
1158397176 18:57088447-57088469 AGGATGGTCTTTAGTAGAGTGGG - Intergenic
1159045530 18:63366491-63366513 AAGATGGCCTGTGCGAGTGACGG - Intronic
1159821296 18:73148063-73148085 AAGATGGTTTCTAAGAGGGAGGG - Intergenic
1160609530 18:80074465-80074487 AAGATGGGCTGAAGGGGAAATGG + Intronic
1161372889 19:3923638-3923660 AAGATGGACTGATGGAGAGATGG + Intronic
1162432280 19:10636308-10636330 GGGAAGGTCTGTGGGAGAGAAGG - Exonic
1163488390 19:17602978-17603000 AGGCTGGACTGGAGGAGAGACGG + Exonic
1163766812 19:19167920-19167942 AAGCTGGTTTGCAGGAGGGAAGG - Intronic
1164441245 19:28282271-28282293 AAGATGGTCTGAAAAAGAGGGGG - Intergenic
1164820343 19:31245459-31245481 AAGATAGGCTGGAGGAGATAGGG - Intergenic
1166972874 19:46582047-46582069 AAGAGGGTCACTTGGAGAGAAGG + Intronic
1167480101 19:49724929-49724951 ACCATTGCCTGTAGGAGAGATGG - Intergenic
925205864 2:2005231-2005253 AAGAACGCCTGCAGGAGAGAAGG - Intronic
925205907 2:2005691-2005713 AAGAACGCCTGCAGGAGAGAAGG - Intronic
925385431 2:3458638-3458660 AACAAGGTCTGAAGGAGAGACGG + Intronic
927284787 2:21345339-21345361 AAGATTCTCTGTAAGAGAGCAGG - Intergenic
927932382 2:27053332-27053354 GATATGGTCTGTGGGAGAGCCGG - Intronic
927951670 2:27174363-27174385 AAGATGGTTAGTAAGACAGAAGG - Intergenic
928324472 2:30308835-30308857 AAGATGGTCCTTAGGAGTGGGGG - Intronic
928921609 2:36533924-36533946 AAGAAGGAATGAAGGAGAGAGGG + Intronic
928921869 2:36535087-36535109 AAGAAGGAATGAAGGAGAGAGGG + Intronic
929087035 2:38178534-38178556 GAGCGGGGCTGTAGGAGAGAAGG + Intergenic
929830435 2:45342731-45342753 AAGCTGATCTGTGGGAGACAAGG - Intergenic
930210579 2:48633222-48633244 AAGATAGTCAGTAGGACAGAGGG - Intronic
933171402 2:79129896-79129918 AAGATAGTCAATATGAGAGAAGG - Intergenic
933284148 2:80366504-80366526 AAGATGATCTGTAGGACACCAGG - Intronic
935192189 2:100787054-100787076 AAGCTGATCTCTAGAAGAGAAGG + Intergenic
935940945 2:108238722-108238744 AAGAAGGTCTGTAGCAGGAATGG + Intergenic
938410881 2:131063006-131063028 AAGATGGACTGAAGGATGGATGG + Intronic
939463146 2:142523580-142523602 AATATGGTCTGTACAGGAGATGG + Intergenic
940098040 2:150000654-150000676 ATGAGGGTCAGTATGAGAGAAGG - Intergenic
941609547 2:167644264-167644286 AAGGTGTTCTGGATGAGAGAAGG + Intergenic
943981810 2:194561620-194561642 GAGATGGTGTTTAGTAGAGATGG + Intergenic
944263746 2:197701752-197701774 AAGATGGTGGTTAGGAGACAGGG - Intronic
945912184 2:215661931-215661953 AAGATTGGCTGAAGTAGAGAAGG - Intergenic
947590183 2:231380967-231380989 AGGATGGAGTGGAGGAGAGATGG - Intergenic
1168911011 20:1446719-1446741 CAGGTGGTTTGGAGGAGAGAAGG - Intronic
1169486167 20:6034921-6034943 GAGATAGAGTGTAGGAGAGAGGG + Intronic
1171540801 20:25953788-25953810 AGGATAGGCTGTAGGAAAGAAGG - Intergenic
1171800268 20:29606529-29606551 AGGATAGGCTGTAGGAAAGAAGG + Intergenic
1171843831 20:30250174-30250196 AGGATAGGCTGTAGGAAAGAAGG - Intergenic
1172366419 20:34353519-34353541 AAGATGGATGGGAGGAGAGATGG - Intergenic
1173465963 20:43281638-43281660 GAGAGGGACAGTAGGAGAGAGGG - Intergenic
1173473966 20:43345527-43345549 AAGATGATGGGTAGGAGTGAGGG - Intergenic
1176889192 21:14293835-14293857 ATGATGGTCTTCAAGAGAGACGG + Intergenic
1177852950 21:26370391-26370413 AAAATGTTCTGGGGGAGAGACGG + Intergenic
1178347213 21:31840441-31840463 AAAAAGGTCAGTAGGACAGAGGG + Intergenic
1178662892 21:34521797-34521819 AAGATGGTCTGTAATGGGGAGGG + Intronic
1178698810 21:34816628-34816650 AAGATGTTCTGGAGGAGATGGGG + Intronic
1182293725 22:29300989-29301011 AAGATGGTTTGATGGAGGGAAGG - Intergenic
1183114962 22:35684800-35684822 CAGAAGCTCTCTAGGAGAGAAGG - Intergenic
1184721731 22:46318587-46318609 AAGATGGTCAGGAGGTGACACGG + Intronic
1184775290 22:46620063-46620085 GAGATGGTGTGAAGGAGACACGG + Intronic
950117336 3:10459938-10459960 AAGTTGGTCTGCTGGACAGAAGG - Intronic
952985006 3:38771209-38771231 AAAATGGTGGGTAGGAGACAGGG - Intronic
953382074 3:42479583-42479605 AAGATGGTAGATAGGAGACAGGG + Intergenic
953818469 3:46183150-46183172 AAGATGGCATGAAGGAGAGCTGG - Intronic
956857154 3:73286536-73286558 AAAAGGGTCAGTAGGAGAGAAGG + Intergenic
957128079 3:76188086-76188108 CACATGGACAGTAGGAGAGATGG - Intronic
957681259 3:83439209-83439231 AAGATGGTGGATAGGAGACAGGG + Intergenic
958819279 3:98953725-98953747 AAGATGGTGGATAGGAGACAGGG - Intergenic
960507671 3:118513165-118513187 AAGAGGGTCTTCAGGGGAGAAGG - Intergenic
960733537 3:120752644-120752666 TAGATGGCCTGTGGAAGAGATGG + Intronic
961849730 3:129803876-129803898 AAGATGCTAAGTATGAGAGATGG - Intronic
962186153 3:133261767-133261789 AAAATGATCTGCAGGAGGGAAGG + Intronic
963306165 3:143655552-143655574 AAGAGGGTATGTAGAGGAGAAGG - Intronic
963316994 3:143770401-143770423 AAGATGGTATACAGCAGAGATGG + Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
967828252 3:193896240-193896262 AAAATGGTTTGAAAGAGAGAAGG + Intergenic
968144282 3:196285486-196285508 AAAAAGGGCTGTAAGAGAGAAGG + Intronic
971538731 4:27787931-27787953 AAAAAGGGCTGTAGGAGAGAAGG - Intergenic
971608725 4:28693353-28693375 AAGAAATTCTGTAGTAGAGAAGG - Intergenic
971778588 4:31000690-31000712 CACATGTTTTGTAGGAGAGAAGG - Intronic
972174187 4:36383010-36383032 AAGATAGCCTGATGGAGAGAAGG - Intergenic
974667663 4:64986064-64986086 AAGGTGGTCAGTAGGAGATAGGG - Intergenic
979531302 4:121771645-121771667 AAGATGGTCGAGAGGAGAGAAGG + Intergenic
981675150 4:147334510-147334532 AAGATGGCCTGTAGTCTAGACGG + Intergenic
983118616 4:163851647-163851669 AAAATGGACTGTGGCAGAGATGG + Intronic
984939464 4:184918612-184918634 CAGATGGTCTGGAGGAGATTTGG + Intergenic
985211902 4:187604192-187604214 AAGAGGGTGGGAAGGAGAGAGGG - Intergenic
986558341 5:9034682-9034704 AATAGGGTGTGTTGGAGAGAGGG + Intergenic
988516412 5:31908452-31908474 AAGATGGTCTGTAGGAGAGAGGG + Intronic
988915076 5:35883927-35883949 AAGAGGGTCAATATGAGAGAAGG - Intergenic
989257185 5:39378487-39378509 AAAATGGTATTTAGGAGTGATGG + Intronic
992390496 5:76326730-76326752 GAGATGGTCTGTCTGTGAGAGGG - Exonic
993681814 5:90887376-90887398 AATACAGTCTGTTGGAGAGATGG - Intronic
994372014 5:98978220-98978242 AAGAAGGTTGGAAGGAGAGAAGG - Intergenic
996201986 5:120686543-120686565 GAGATGGGGTGTAGGAGGGAGGG - Exonic
997753938 5:136376945-136376967 CAGATTATCTCTAGGAGAGATGG + Intronic
998664876 5:144285454-144285476 AAGAGGGGCTGTATGACAGAAGG - Intronic
999426346 5:151490602-151490624 AACGTGGTATGTAGGAGAGTTGG + Exonic
999495559 5:152093252-152093274 AAGATGTCCTGTAGCAAAGAGGG - Intergenic
999566499 5:152868321-152868343 AAGATGGTCATTTGGAGGGAGGG - Intergenic
1000156232 5:158554554-158554576 AATATGGTGTGCAGGAGAAATGG - Intergenic
1000296032 5:159914361-159914383 AAGATGGTCAGGAGCAGAGCTGG - Intergenic
1000701907 5:164461623-164461645 GAGATGGTCTATAGGAGGAAGGG + Intergenic
1001228966 5:169969546-169969568 CAGGTGGTATGTAGGAGAGTGGG + Intronic
1001453212 5:171841997-171842019 AAGATGGTTTCGAGGAGAAAGGG - Intergenic
1001571693 5:172734245-172734267 AATATCGTCTGCAGGAGAGAAGG - Intergenic
1003142203 6:3481042-3481064 AGGATGATCTGGAGGAGACAAGG - Intergenic
1003248132 6:4401276-4401298 AAGTTGTTCAGTGGGAGAGAGGG - Intergenic
1003317329 6:5024466-5024488 CAGAGGCTCTGGAGGAGAGAGGG + Intergenic
1003480521 6:6527550-6527572 AATTTGTTCTGTAGCAGAGATGG + Intergenic
1004147524 6:13082118-13082140 AACATGGAGTGTATGAGAGAGGG - Intronic
1004531848 6:16461408-16461430 TGGATGGTCTGGAGGAGATATGG - Intronic
1004774436 6:18827011-18827033 AAAATGCTCTGTGGGGGAGATGG - Intergenic
1005307069 6:24524334-24524356 AAGATTGTGTGTGGGAAAGAAGG + Intronic
1005361124 6:25032038-25032060 AGGATGGTTTGAAGGGGAGAGGG - Intronic
1007272755 6:40650811-40650833 GTGATGGTCTGTGGGAGGGATGG - Intergenic
1009027361 6:58016047-58016069 ATGAGGGTCTTCAGGAGAGAAGG - Intergenic
1009777542 6:68224098-68224120 ATGAGGTTCTTTAGGAGAGAGGG + Intergenic
1011482281 6:87807160-87807182 CAGATGGTGGGTAAGAGAGAGGG - Intergenic
1011716615 6:90112177-90112199 AAGATGGCCTGGAGAAGAAAAGG - Intronic
1011896264 6:92229788-92229810 AACATGGTGGGTTGGAGAGAGGG - Intergenic
1012422316 6:99078604-99078626 AAGATGGTGGGAGGGAGAGACGG + Intergenic
1013045531 6:106481539-106481561 CAGAGGGTCTCCAGGAGAGAAGG - Intergenic
1016452804 6:144200844-144200866 AAGATGGTCAGTAGGATAGAAGG - Intergenic
1018089672 6:160334721-160334743 AATGTGCTCTGTAGGATAGAAGG - Intergenic
1018244946 6:161813741-161813763 AAGAGGATCTGTAGCAGGGAAGG - Intronic
1018455784 6:163951179-163951201 AAGATGGTCTGTAGGGAAGGTGG + Intergenic
1018833113 6:167461253-167461275 AGGTTGGTGTGAAGGAGAGAGGG + Intergenic
1018834042 6:167470228-167470250 CAGATGGTGTGAAGTAGAGATGG + Intergenic
1019318917 7:406037-406059 AGGGTGGTCTGGAGGAGGGAGGG - Intergenic
1019430640 7:997426-997448 AGGAGGGTCTGGAGGAGGGAAGG + Exonic
1021752048 7:23811538-23811560 AAGATGGTCAGTAAGACATAGGG - Intronic
1022058044 7:26761035-26761057 AAGATAGTCTGTAGTAATGAAGG + Intronic
1023863290 7:44227632-44227654 AGGAGGGTCTGGAGGACAGAGGG + Intronic
1023953291 7:44865119-44865141 AGGAAGGTCTGAAGGAGAGGAGG + Intergenic
1024120215 7:46229254-46229276 AAGATGTTCCGTAGATGAGAAGG + Intergenic
1025292228 7:57740037-57740059 AGGATAGGCTGTAGGAAAGAAGG - Intergenic
1028195302 7:87899934-87899956 AAGATGGACGGTAGCAGTGATGG + Intronic
1029352047 7:100020434-100020456 AAGGTGGATTGTGGGAGAGAAGG + Intronic
1031943661 7:127816001-127816023 CAGCTGGTCTGCAGGAGGGAAGG - Intronic
1032353912 7:131191465-131191487 AGGATGATGTGAAGGAGAGAAGG + Intronic
1033849922 7:145482531-145482553 TTGATGGTCTCTAGGTGAGAGGG + Intergenic
1034408471 7:150922559-150922581 GAGAAGGCCAGTAGGAGAGAAGG + Intergenic
1036016707 8:4793461-4793483 GAGATGGTGGGGAGGAGAGAGGG - Intronic
1036166882 8:6443662-6443684 ATGATGGTGTGTAGCAGAGGGGG + Intronic
1040559659 8:48513381-48513403 TATTTGGTCTGTAGGAGAGGAGG + Intergenic
1040861398 8:52002818-52002840 AAGCTGGTCTAGAGGAGACAGGG - Intergenic
1041002375 8:53465306-53465328 CAGATGGTCTGGAGGAGATTTGG - Intergenic
1042310269 8:67372229-67372251 GAGAAGGTCATTAGGAGAGAGGG + Intergenic
1043357177 8:79427041-79427063 AAGATAGTCTGTATGATTGACGG + Intergenic
1043537952 8:81226733-81226755 AAGATGGTGGATAGGAGACAAGG - Intergenic
1044005002 8:86928791-86928813 CAGATGGTCTGTAGGAGATTTGG + Intronic
1044428924 8:92086233-92086255 AACATGGTAAGAAGGAGAGAAGG - Intronic
1045051842 8:98334598-98334620 AGGATGGTTTGCAGGGGAGAAGG - Intergenic
1046608652 8:116399526-116399548 AACATTGCCTGTGGGAGAGAGGG + Intergenic
1047842256 8:128766199-128766221 ATGATGGTGTATAGGAGACAGGG + Intergenic
1048160777 8:132019053-132019075 AAGTTGGCCTGTAAAAGAGACGG - Intergenic
1048554619 8:135462507-135462529 AAGATGTTCCTTAGGAAAGAGGG - Intronic
1049702884 8:144023078-144023100 AAGAGGGTCCTGAGGAGAGAGGG - Intronic
1049974709 9:850302-850324 AAGATGGAGTGTGGGAGAGTGGG + Intronic
1050076839 9:1874677-1874699 AAGCTGGTGTGTGTGAGAGAAGG - Intergenic
1050089763 9:2006053-2006075 AAGAGGGAGGGTAGGAGAGAGGG - Intergenic
1050220773 9:3387160-3387182 AAGATTGTCTTTGGGAGTGAGGG - Intronic
1051820057 9:21154098-21154120 AGGATTGTGTGTAGAAGAGAAGG + Intergenic
1052264394 9:26554544-26554566 AAGCTGGTCCTTAGGAGAGCTGG - Intergenic
1052835435 9:33246601-33246623 CAGATGGGCTGTGGAAGAGAAGG - Exonic
1053532098 9:38892733-38892755 AGGATAGTATGAAGGAGAGATGG - Intergenic
1054204321 9:62117142-62117164 AGGATAGTATGAAGGAGAGATGG - Intergenic
1054634040 9:67471222-67471244 AGGATAGTATGAAGGAGAGATGG + Intergenic
1056061664 9:82889592-82889614 AGGATGGCCCCTAGGAGAGATGG - Intergenic
1057566715 9:96171472-96171494 AAGATGGAATGAAGGAGGGAAGG + Intergenic
1058636673 9:107044695-107044717 AAGGTGAGCTCTAGGAGAGAAGG + Intergenic
1058909317 9:109506479-109506501 AAGAAGGTAGGTAGGAAAGAAGG - Intergenic
1059534315 9:115067042-115067064 AACATGGTCTTTATGAGAAAGGG + Intronic
1059627025 9:116078423-116078445 ATGATGGTGTGTAGGTGGGAAGG + Intergenic
1059678965 9:116567616-116567638 AAGATGGATTGAAGGAGTGAAGG + Intronic
1059829856 9:118083261-118083283 AAAATGGTCAGTAGGACAGAAGG - Intergenic
1060194553 9:121615184-121615206 AAGATGCTTTGTAGAAAAGAAGG + Intronic
1061453702 9:130682279-130682301 AAGCTGGCCTAAAGGAGAGAAGG - Exonic
1062130671 9:134891443-134891465 AAGCTCCTCTGCAGGAGAGAGGG + Intergenic
1187500234 X:19833212-19833234 AAGAAGGACTGTGGGAAAGAGGG - Intronic
1188254221 X:27940281-27940303 ACAATGTTCTGGAGGAGAGAGGG - Intergenic
1189373495 X:40448347-40448369 AAGGTGGTATGGAGGAAAGATGG - Intergenic
1192565503 X:72159944-72159966 AAGATAGTCAGTAGGACAGAAGG + Intergenic
1192718732 X:73669688-73669710 CAAATGGTCTGGAGGAGAAAGGG - Intronic
1194231477 X:91330593-91330615 AAAATGGTATGTAGCAGAAATGG - Intergenic
1195138104 X:101931523-101931545 AAGATGGACTGAAGCAGAGAGGG - Intronic
1195672496 X:107481653-107481675 AAGCTGGTCTGGAGAAGAGCTGG + Intergenic
1195789058 X:108561271-108561293 AGGTTAGTCTGTAGGAGAAAGGG + Intronic
1197226130 X:123958777-123958799 AAGATGGTCTATAAAAGAAATGG + Intergenic
1198219658 X:134587704-134587726 AAAATGGTAAGTAGGGGAGATGG + Intronic
1198770308 X:140123848-140123870 AAGATGGTGGATAGGAGACAGGG - Intergenic
1199560497 X:149158167-149158189 AACAGGGCCAGTAGGAGAGAGGG - Intergenic
1199779712 X:151046937-151046959 AAGATGGGATGTAGTGGAGAAGG - Intergenic
1201496182 Y:14593380-14593402 CAGATGGTCTGGAGGAGATTTGG + Intronic