ID: 988519371 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:31931936-31931958 |
Sequence | CATTAATGGCAGAAGTTGGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 2296 | |||
Summary | {0: 1, 1: 1, 2: 2, 3: 137, 4: 2155} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
988519363_988519371 | 22 | Left | 988519363 | 5:31931891-31931913 | CCACAGCCGCACGGAGCTTTCTC | 0: 1 1: 0 2: 1 3: 11 4: 105 |
||
Right | 988519371 | 5:31931936-31931958 | CATTAATGGCAGAAGTTGGAAGG | 0: 1 1: 1 2: 2 3: 137 4: 2155 |
||||
988519365_988519371 | 16 | Left | 988519365 | 5:31931897-31931919 | CCGCACGGAGCTTTCTCAGGTGT | 0: 1 1: 0 2: 1 3: 14 4: 122 |
||
Right | 988519371 | 5:31931936-31931958 | CATTAATGGCAGAAGTTGGAAGG | 0: 1 1: 1 2: 2 3: 137 4: 2155 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
988519371 | Original CRISPR | CATTAATGGCAGAAGTTGGA AGG | Intronic | ||
Too many off-targets to display for this crispr |