ID: 988519371

View in Genome Browser
Species Human (GRCh38)
Location 5:31931936-31931958
Sequence CATTAATGGCAGAAGTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2296
Summary {0: 1, 1: 1, 2: 2, 3: 137, 4: 2155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988519363_988519371 22 Left 988519363 5:31931891-31931913 CCACAGCCGCACGGAGCTTTCTC 0: 1
1: 0
2: 1
3: 11
4: 105
Right 988519371 5:31931936-31931958 CATTAATGGCAGAAGTTGGAAGG 0: 1
1: 1
2: 2
3: 137
4: 2155
988519365_988519371 16 Left 988519365 5:31931897-31931919 CCGCACGGAGCTTTCTCAGGTGT 0: 1
1: 0
2: 1
3: 14
4: 122
Right 988519371 5:31931936-31931958 CATTAATGGCAGAAGTTGGAAGG 0: 1
1: 1
2: 2
3: 137
4: 2155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988519371 Original CRISPR CATTAATGGCAGAAGTTGGA AGG Intronic
Too many off-targets to display for this crispr