ID: 988519776

View in Genome Browser
Species Human (GRCh38)
Location 5:31935158-31935180
Sequence CTTTGTTAGCTATACTTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988519776_988519778 -6 Left 988519776 5:31935158-31935180 CCTTACAAGTATAGCTAACAAAG 0: 1
1: 0
2: 2
3: 6
4: 130
Right 988519778 5:31935175-31935197 ACAAAGGACCTTGTGAGTATTGG 0: 1
1: 0
2: 0
3: 13
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988519776 Original CRISPR CTTTGTTAGCTATACTTGTA AGG (reversed) Intronic
906002417 1:42438328-42438350 CTTTGTTGGTTTTACTCGTAGGG - Intronic
911785344 1:101939256-101939278 CTTTGGTAACTAAACTTGGATGG + Intronic
916703935 1:167326786-167326808 CTTTGTTAGCAATGATTGTCTGG + Intronic
916955565 1:169830305-169830327 CTTTGTTAGCTATGGATGCATGG + Exonic
918741134 1:188131726-188131748 CTTTTTTAGTTATCGTTGTAGGG - Intergenic
919215301 1:194545792-194545814 TTTTGTTACCTGTACTTGTTGGG + Intergenic
921460828 1:215424506-215424528 CTTTCTTAGCTATAATGCTATGG - Intergenic
921460911 1:215425756-215425778 TTGTGTTAGCCATACTTGAAGGG - Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
924527508 1:244864807-244864829 CTTTGGTGGCTATACTCGTTTGG + Intergenic
1066025199 10:31349947-31349969 TTTTGTTGCCTATACTTTTAGGG + Intronic
1066035646 10:31480570-31480592 ATTTTTTAGCTCTACTTATAAGG + Intronic
1072381422 10:94875586-94875608 CTTGGTTAGGTATACTTCTAAGG + Intergenic
1072863200 10:99029092-99029114 TTTGGTTGCCTATACTTGTAAGG - Intronic
1073968458 10:109018830-109018852 CTTTGTTCCCTAAACTTGTATGG + Intergenic
1074939914 10:118224596-118224618 TTCTGTTAGCTATTCTTTTAGGG - Intergenic
1075188143 10:120281950-120281972 CTCTGTTATCTCTACTTATAAGG + Intergenic
1077796104 11:5494089-5494111 TTTTGCTAGCAATACTTGTATGG - Intronic
1078973571 11:16444784-16444806 CTTTGTTAGAAATAGTTGAATGG + Intronic
1080279803 11:30543986-30544008 CTTTGTTAGCTATAATTAGTTGG - Intronic
1082800781 11:57413459-57413481 ATTTGTTAGAGATACATGTACGG + Intronic
1084458200 11:69281042-69281064 CTTTGTCAGCTATCCTTGAGGGG + Intergenic
1084990001 11:72913847-72913869 CCTTGTTAGCTGTATTTCTAGGG - Intronic
1086367375 11:86121385-86121407 CTGTGTTAACTATACTTAAAAGG - Intergenic
1087488010 11:98783063-98783085 CTTTGGCTGCTATATTTGTATGG + Intergenic
1089714865 11:120349245-120349267 CCTTTTAAGCTATAATTGTATGG - Intronic
1090757660 11:129807718-129807740 CTTTGTTAGGTATATTCCTAAGG - Intergenic
1091199742 11:133766252-133766274 TTTTGTTAGCTGTTCTTTTAGGG - Intergenic
1092691634 12:11118026-11118048 CTTGGTTGCCTGTACTTGTAGGG - Intronic
1096461599 12:51824485-51824507 CTTTTTAAGCTACACTTTTATGG - Intergenic
1096940134 12:55334393-55334415 CTTTGTAAGTTATAGCTGTAGGG - Intergenic
1098505866 12:71249866-71249888 TTTTGTTAACCATACTTTTAAGG + Intronic
1101084969 12:101226430-101226452 CTTTGTGAGCTATATGTGAAGGG + Intergenic
1102026151 12:109715144-109715166 CTTTGTTAGCTTTACGGGTGGGG - Intronic
1107830231 13:44368522-44368544 CTTTACTAGCTAAACTTGAATGG - Intergenic
1108631218 13:52284703-52284725 TTTGGTTACCTGTACTTGTAGGG + Intergenic
1108655472 13:52527898-52527920 TTTGGTTACCTGTACTTGTAGGG - Intergenic
1111138101 13:84077632-84077654 TTTTATCAGATATACTTGTATGG - Intergenic
1111278857 13:85990998-85991020 CTTTGTTGCCTAGACTTTTAGGG + Intergenic
1111840560 13:93444640-93444662 CTTTGTTTGCTTTACATGCATGG - Intronic
1112731054 13:102362794-102362816 TTTTTTTTTCTATACTTGTATGG - Intronic
1117208226 14:53467430-53467452 CTTTTTTGGCTACCCTTGTAAGG + Intergenic
1118968310 14:70609307-70609329 CTATGTTTGCTATGCCTGTAGGG - Intergenic
1119033307 14:71209440-71209462 CTTTGTTAGTTATTAGTGTAGGG - Intergenic
1120361724 14:83513078-83513100 CTTTGTCAGCTATACATTTCAGG - Intergenic
1123826525 15:24087612-24087634 CTTTGTTAGGTAGATTTGTGTGG - Intergenic
1123851024 15:24357268-24357290 CTTTGTTAGGTAGATTTGTGTGG - Intergenic
1125099724 15:35898081-35898103 CTGGGGTAGCTATACTTGCATGG - Intergenic
1125112458 15:36049105-36049127 TTTTGTTAGCTTTACTGGAAAGG - Intergenic
1127156278 15:56128823-56128845 CTTTATTAGCTCTAATTATAGGG - Intronic
1127633373 15:60846982-60847004 CTTTTTGGGCTATACTTTTATGG + Intronic
1130035800 15:80360295-80360317 ATTTGTTTCCTATACTTCTATGG + Intronic
1136566882 16:31076008-31076030 TTTCCTTAGCTATACCTGTAGGG + Intronic
1139141925 16:64275559-64275581 GTTTTGTAGCTATTCTTGTAGGG - Intergenic
1140577781 16:76192600-76192622 CATTTTTACATATACTTGTATGG + Intergenic
1143703695 17:8681756-8681778 CTTTGGCAGCGATACTGGTATGG - Intergenic
1156224680 18:35092573-35092595 TTTTGTTAGCTGTGCTTTTAAGG - Intronic
1156816052 18:41312765-41312787 CTTTGTTAGTTAAACTTATTGGG - Intergenic
930643793 2:53881931-53881953 CTTTGTAAGCTATTCTTGGTTGG + Intronic
931764101 2:65439335-65439357 CTTTGTTAGCTAGAATTTTGGGG - Intergenic
932049577 2:68385080-68385102 CCTTGTTGGCTACATTTGTAAGG + Intronic
939482412 2:142766131-142766153 TTTTGTTATCTATGCTTTTAAGG - Intergenic
941846210 2:170136281-170136303 CTTTGTTGCCTATACTTTTGAGG - Intergenic
942911137 2:181245735-181245757 CTTTGTCATATATACTTCTAAGG + Intergenic
943080840 2:183257477-183257499 TTTTGTTAGCTATTTTTTTATGG - Intergenic
943254598 2:185578043-185578065 TATTGTTAGCTATATTTTTATGG + Intergenic
943620963 2:190147717-190147739 CTTGGTTAGGTATATTTCTAAGG + Intronic
944046952 2:195423229-195423251 ATTTCTTTGCTATACTTATAGGG - Intergenic
944601953 2:201312352-201312374 CTTGGTTAGCTATATTTTTAGGG - Intronic
1171164791 20:22960197-22960219 CTTTCTTTGCTTTCCTTGTAAGG + Intergenic
1171446498 20:25207888-25207910 CTTCGTTGGCTATGCTTCTAGGG + Intronic
1172489711 20:35326054-35326076 CTTTGTGATCTGTACTTCTAGGG - Intronic
1177174087 21:17685255-17685277 CTTTGTTAGGTATATTCCTAAGG + Intergenic
1177652625 21:23978370-23978392 CTTTTTCAGCTATACTAGTTGGG - Intergenic
1177868476 21:26541597-26541619 TTCTGTTAGCTTTTCTTGTAGGG - Intronic
1178775684 21:35548218-35548240 CTATGTTAGCTATGCTCATAAGG + Intronic
950021264 3:9789432-9789454 CTTTGGTAGCTTTACTTCTCAGG + Intronic
951408900 3:22337795-22337817 CCATGTTAGTTATACCTGTAAGG + Intronic
957738785 3:84235162-84235184 CTATGTTAACTATACCTGTTAGG + Intergenic
959274965 3:104266996-104267018 CTTGGTTAGGTATATTTCTAAGG + Intergenic
963383915 3:144566919-144566941 CTTGGTTTGCTATATTTTTAAGG - Intergenic
965230763 3:166049179-166049201 TTTTGTTAGGTATACTTTTTTGG + Intergenic
974993078 4:69117352-69117374 CTTGGTTAGGTATATTTCTAAGG - Intronic
976998100 4:91461592-91461614 TTGGATTAGCTATACTTGTATGG + Intronic
978719655 4:111893625-111893647 CTTGGTGATTTATACTTGTAAGG - Intergenic
978939757 4:114422131-114422153 CATTGTTTGCTGTACTTGGATGG + Intergenic
979357316 4:119720043-119720065 CTTGGTTAGGTATATTTCTAAGG - Intergenic
979644124 4:123047586-123047608 CTTTGTTACCTGTACTTTTGAGG + Intronic
980069381 4:128227546-128227568 CTTTATTATTTATCCTTGTAAGG - Intergenic
980185047 4:129450481-129450503 CCTTGTTAGCTGTATTTTTAGGG - Intergenic
980274458 4:130631581-130631603 CTGTGTGAGGTATACATGTAAGG - Intergenic
980275075 4:130640127-130640149 TTTTGGTAGCTGTAGTTGTAGGG + Intergenic
981204911 4:142028998-142029020 CTTTGTTATTTTTACTTGGATGG - Intronic
981497396 4:145409663-145409685 CTTTGTTCGCTGTACCTGTTAGG - Intergenic
981520541 4:145657157-145657179 TTTTGTTAGCTTTAATTTTAAGG + Exonic
985117098 4:186603093-186603115 CTTTGATGGCTATACATGAAAGG - Intronic
987963384 5:24839763-24839785 CTTTTTTAGATGTACTTTTAAGG - Intergenic
987979509 5:25063528-25063550 CTTTCATAGCTACACTTTTAAGG - Intergenic
988519776 5:31935158-31935180 CTTTGTTAGCTATACTTGTAAGG - Intronic
995021923 5:107376918-107376940 TTTATTTAGTTATACTTGTACGG + Exonic
1003063534 6:2881913-2881935 CTTTGTTAGGTATAGTCCTAAGG - Intergenic
1003988913 6:11466307-11466329 ATTTGTTGTCTATACATGTATGG - Intergenic
1007014472 6:38449890-38449912 CTTTGTTGGCTATGCTTTTGAGG - Intronic
1009918295 6:70024325-70024347 ATTTGTTATCTTTACTGGTAGGG + Intronic
1010479142 6:76328373-76328395 CATTATTAACTATAATTGTAAGG - Intergenic
1012287941 6:97416093-97416115 CTTTGGTTGCCATACTTGTGGGG + Intergenic
1013850714 6:114511334-114511356 CTTTGTTAGGTATATTCCTAAGG - Intergenic
1014339520 6:120187167-120187189 CTGTGTTGGCAAAACTTGTAGGG + Intergenic
1016983763 6:149878419-149878441 CTTGGTTAGATATACTTCTAGGG - Intergenic
1017275443 6:152562022-152562044 CTTTGTTGGCTGTGCTTATAAGG - Intronic
1017431172 6:154372543-154372565 TTTTTTTGGCCATACTTGTAGGG - Intronic
1018452782 6:163924680-163924702 CTTTGGGAGCTGTACCTGTAAGG + Intergenic
1027704853 7:81517128-81517150 TTTTTTAAGCTATACTTGGAAGG - Intergenic
1032145663 7:129377760-129377782 ACTTGTAAGCTATACTTGTTTGG - Intronic
1032341893 7:131081680-131081702 CTTTGTTAACTGAACTTGCAGGG - Intergenic
1032869006 7:135960524-135960546 CTTTGTTACCTATCCTTTAAAGG - Intronic
1038159832 8:25025966-25025988 CTTTCTTAGCAATACATATAAGG - Intergenic
1039222476 8:35349136-35349158 CTTTGTCAAGTATACTTGTGGGG - Intronic
1040672784 8:49712688-49712710 CTTTGTTTTCTATATTTTTATGG + Intergenic
1050075078 9:1854726-1854748 TTTTGGGAGCTATACTTGCAAGG - Intergenic
1050873037 9:10599332-10599354 CTTTGTTTCCTATACTTGTTTGG + Intronic
1051733865 9:20178123-20178145 CCTTTTTACCTGTACTTGTAAGG - Intergenic
1052773136 9:32707617-32707639 CTTTGGTAGCTATATTTGTAAGG + Intergenic
1055538908 9:77279652-77279674 CTTTATTAGTTATACTGATATGG - Intronic
1055668742 9:78578920-78578942 ATTTGTTAACTATTTTTGTAAGG - Intergenic
1056162680 9:83912552-83912574 CTTTGTTATCTATAGATGTGGGG - Intronic
1056357668 9:85818969-85818991 CTTTGTTATCTATAGATGTGGGG + Intergenic
1058767109 9:108192249-108192271 CTTTTTTAGCCATATTTGTGTGG - Intergenic
1062632547 9:137471652-137471674 TTTTGTTAACTATATTTCTAAGG - Intronic
1186225854 X:7398166-7398188 GTATGTTTGCTATACTTATATGG - Intergenic
1188923084 X:36003349-36003371 CTTTTGCATCTATACTTGTAAGG + Intergenic
1189557960 X:42164934-42164956 CTTTTTTCTCTATTCTTGTATGG + Intergenic
1192846108 X:74908631-74908653 CTTTGTTAGCTATACTTACATGG - Intronic
1192993057 X:76483088-76483110 CTTGATTAGGTATATTTGTAAGG + Intergenic
1193462497 X:81807762-81807784 CTTTGTTAGACATACCTATATGG + Intergenic
1193630177 X:83875823-83875845 CTTTGTTTCCTATGCTTGCATGG + Intronic
1195828299 X:109026999-109027021 TTTTGTTGCCTATGCTTGTAGGG - Intergenic
1196071381 X:111526792-111526814 CTTTGTTGCCTCTACTTGTGGGG - Intergenic
1200272487 X:154699049-154699071 CTTTGTCAGCTGTATTTGCAAGG + Intronic