ID: 988523334

View in Genome Browser
Species Human (GRCh38)
Location 5:31965306-31965328
Sequence TCTGATTTGCATAGGGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 3, 1: 101, 2: 160, 3: 89, 4: 214}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988523328_988523334 9 Left 988523328 5:31965274-31965296 CCAGGTATGTGTAGAGGCTGGAG 0: 1
1: 6
2: 11
3: 27
4: 202
Right 988523334 5:31965306-31965328 TCTGATTTGCATAGGGCACAGGG 0: 3
1: 101
2: 160
3: 89
4: 214
988523322_988523334 30 Left 988523322 5:31965253-31965275 CCCAAGTGGGGTGGAAACCAGCC 0: 3
1: 6
2: 14
3: 28
4: 132
Right 988523334 5:31965306-31965328 TCTGATTTGCATAGGGCACAGGG 0: 3
1: 101
2: 160
3: 89
4: 214
988523323_988523334 29 Left 988523323 5:31965254-31965276 CCAAGTGGGGTGGAAACCAGCCA 0: 3
1: 4
2: 16
3: 25
4: 141
Right 988523334 5:31965306-31965328 TCTGATTTGCATAGGGCACAGGG 0: 3
1: 101
2: 160
3: 89
4: 214
988523326_988523334 13 Left 988523326 5:31965270-31965292 CCAGCCAGGTATGTGTAGAGGCT 0: 1
1: 4
2: 13
3: 26
4: 102
Right 988523334 5:31965306-31965328 TCTGATTTGCATAGGGCACAGGG 0: 3
1: 101
2: 160
3: 89
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988523334 Original CRISPR TCTGATTTGCATAGGGCACA GGG Intronic
902866916 1:19285788-19285810 GCTGCTATGCAGAGGGCACAGGG + Intronic
903618441 1:24679889-24679911 TTTGATTTGCATTTGCCACATGG + Intergenic
903959807 1:27049749-27049771 TCTGATTTGCATGGGGCTCAGGG + Intergenic
904254472 1:29245897-29245919 TCTACATTGCATTGGGCACATGG + Intronic
904290654 1:29483827-29483849 TCTGATTCTCAGATGGCACAAGG - Intergenic
904371470 1:30050194-30050216 TTTTATTTGCATATGGCTCAGGG - Intergenic
905086647 1:35385460-35385482 AATGATTTGCAAAGCGCACACGG - Exonic
905314591 1:37073885-37073907 TCAGATTTACATTGAGCACATGG + Intergenic
905477592 1:38239722-38239744 GCTGATTTACATAGAACACAAGG + Intergenic
905696706 1:39979931-39979953 TTTGATTTGCATAGGGCTCAGGG - Intergenic
906212860 1:44021819-44021841 TCTGAGGTGCATAGGGCAGCTGG - Intronic
906973071 1:50538721-50538743 ACTGATTTGCATAGGGTAAATGG - Intronic
907184414 1:52598875-52598897 TCTGATTTGCATAGGGCTCAGGG + Intergenic
907533038 1:55121151-55121173 TCTGATATCCATAGCTCACAAGG - Intronic
907568243 1:55457514-55457536 TCTGATTTGCATAGGGCCCAGGG + Intergenic
908511486 1:64853187-64853209 TCTAATTTGCACATGGCAAAGGG + Intronic
908910019 1:69062370-69062392 TCTGATTTGCATAGGGCTCAGGG + Intergenic
908912744 1:69091505-69091527 TCTGATTTGCATAGGGCTCAGGG - Intergenic
909018937 1:70410332-70410354 TCTGTATTGCTTAGGGAACAGGG + Intergenic
909655375 1:78026021-78026043 TTTTTTTTGCATAGGGCACCAGG + Intronic
909800278 1:79797548-79797570 TCTGGTTTGCATAGGGCCCAGGG + Intergenic
911070607 1:93829168-93829190 ACTGATTTACTTAGGGCTCAGGG + Intronic
912047682 1:105480687-105480709 TCTGATTTGCATAGGGCTCAGGG - Intergenic
912375265 1:109204542-109204564 TCTTATTTGAAAAGAGCACAAGG + Intronic
912609411 1:111028176-111028198 TCTGATTTGCATAGGGCCCAGGG - Intergenic
912610002 1:111033212-111033234 TCTGATTTGCATAGTGCCCAGGG - Intergenic
915116781 1:153606389-153606411 TCTGATTTGTATAGGGCTCAGGG - Intergenic
916280436 1:163045532-163045554 TCTGATTTTCATGGGGCTAAAGG + Intergenic
916771414 1:167912532-167912554 TCTGATTTGCATAGGGTTCAGGG - Intronic
917367430 1:174247760-174247782 TCTGATTTGCATAGGGCTCATGG - Intronic
917769929 1:178266734-178266756 TCTTATTTGCATAGGGCTCAGGG + Intronic
918002643 1:180512300-180512322 TCTGATTTGCGTAGGGCTCAGGG + Intergenic
918771316 1:188564115-188564137 TCTGATTCGCACAGGGTCCAGGG - Intergenic
920639742 1:207740916-207740938 TCTGATTTGCATAGGGCTCAGGG - Intergenic
920910655 1:210213399-210213421 TCTGATTTATATAGGGCCCAGGG - Intergenic
921049624 1:211501677-211501699 TCTGATTTGCTGATGCCACAAGG - Intergenic
922550632 1:226491602-226491624 TCTGATTTGCATAGGGCCCAGGG + Intergenic
922637150 1:227185546-227185568 TCTGATTTGCATAGAGCTCAGGG - Intronic
922849867 1:228723367-228723389 TCTGATTTGCATAGGGCTCAGGG + Intergenic
924278216 1:242409687-242409709 GCTGATTTGCACTGGGCTCAGGG + Intronic
924576121 1:245282635-245282657 TCTGATTTGCATAGGGCTTAGGG - Intronic
1063241462 10:4174248-4174270 TCTGATTTGGTTCGGGTACAGGG - Intergenic
1063278435 10:4597405-4597427 TCTTATTTGTCTATGGCACATGG + Intergenic
1063281717 10:4636999-4637021 TCGGCTTTGCTTAGAGCACAGGG - Intergenic
1065462593 10:25984460-25984482 TCTGGTTTGCATAGGGCCCAGGG - Intronic
1065780510 10:29162335-29162357 TCTGATTTGCATAGGGCTTAGGG + Intergenic
1065781417 10:29171783-29171805 TTTGATTTGCATAGAGTTCACGG + Intergenic
1066110046 10:32187750-32187772 TCTGATTTACATAGGGCTCAGGG + Intergenic
1066115090 10:32232756-32232778 ACTGATTTACATAGGGCCCAGGG - Intergenic
1066471290 10:35700781-35700803 TCTGGTTTGCATAGGGCTCAGGG - Intergenic
1067304148 10:45044304-45044326 ACTGATTGACATAGGGCCCAGGG + Intergenic
1067512291 10:46906110-46906132 TCTGAGGTGCATAAGGCAGAAGG - Intergenic
1068161539 10:53271560-53271582 TCTGATTTTCATAGGGCTCAGGG - Intergenic
1068349057 10:55820115-55820137 TTTGATTTGCATAGTGCTCAGGG + Intergenic
1068522474 10:58093145-58093167 TCTGATTTACATAGGGCCCAGGG + Intergenic
1069180123 10:65348719-65348741 ATTGATTTACATAGGGCTCAGGG + Intergenic
1069806739 10:71130922-71130944 TCAGATTTACAGAGGACACAAGG + Intergenic
1070012551 10:72490787-72490809 TTTGTTGTGCAAAGGGCACATGG - Intronic
1070592575 10:77811350-77811372 TCTGCTCTGCTCAGGGCACAGGG - Intronic
1071850013 10:89558967-89558989 TCTAATTAGCATAGGGCACAGGG + Intergenic
1071902454 10:90135833-90135855 TTTGATTTGCATAGGGCCCAGGG - Intergenic
1071902877 10:90139776-90139798 TTTGATTTGCATAGGGCCCAGGG - Intergenic
1072192207 10:93085271-93085293 TCTGATTTGCCTGGGACTCAAGG + Intergenic
1072677643 10:97480187-97480209 TCTGATTTGCATAGGGCTCGGGG - Intronic
1073759261 10:106612450-106612472 TCTGATTTGCATAGGGCTTAGGG + Intronic
1073838502 10:107471435-107471457 TCTGATTTCCATAGGGCTCAGGG + Intergenic
1073970085 10:109038122-109038144 ATTGATTTACATAGGGCTCAGGG + Intergenic
1074298799 10:112214743-112214765 TCTGATTTGCAAACGGCACATGG - Intronic
1074468508 10:113705848-113705870 TCTTAATAGCATAGGCCACAAGG + Intronic
1074634973 10:115304626-115304648 TCTGATTTGCATAGAGCTTAGGG + Intronic
1075366084 10:121891209-121891231 ACTGATTTACATGGGGCTCAGGG + Intronic
1078142314 11:8701397-8701419 TTTGATTTGCATAGGGCTTAGGG - Intronic
1078702688 11:13703531-13703553 TCTTATTTGCAAAGTGCATATGG + Intronic
1080725662 11:34897867-34897889 TCTGATTTTCATAGGGCCCAGGG - Intronic
1080916485 11:36665582-36665604 ACTGATTTACATAGGCCTCAGGG - Intergenic
1081189029 11:40080774-40080796 TCTGATTTGCATATGGCTCGGGG - Intergenic
1083213669 11:61205000-61205022 TGTGACTGGCACAGGGCACAGGG + Intronic
1083672085 11:64305456-64305478 TCTGATTAGCATAGGACCCCGGG + Intergenic
1084914858 11:72421148-72421170 TCTGATTTGCATAGGACTCAAGG - Intronic
1085419821 11:76346295-76346317 TCTGTTTGGCATCAGGCACAAGG - Intergenic
1086058482 11:82675936-82675958 TCTGATTTGCATGGGGCCCAGGG + Intergenic
1086059231 11:82683128-82683150 TCTGATTTGCATAGGGCCCAGGG + Intergenic
1086461308 11:87008490-87008512 TCTGTTTTGCATAGTGAGCAGGG - Intergenic
1087936530 11:104039846-104039868 TCTTATTTGCATATATCACATGG + Intronic
1090115242 11:123965077-123965099 TCTGATTTGCATATCCCTCATGG + Intergenic
1090324541 11:125873763-125873785 TCTGATTTACATAGGGCCTAGGG - Intergenic
1092337510 12:7646312-7646334 TCTGATTTGCATAGGGCCCAAGG - Intergenic
1092575980 12:9783038-9783060 TCTGATTTCCATAGGGCTCAAGG + Intergenic
1092629281 12:10361168-10361190 TTTGATTTGCATAGGGCTAAGGG + Intergenic
1093066747 12:14666093-14666115 TCTGATTTATATAGGGCCCAGGG + Intronic
1094289460 12:28830744-28830766 TCTGATGTGCATAGGGCCCATGG - Intergenic
1094476417 12:30844057-30844079 TCTGATTTGTATAGGGCCCAAGG - Intergenic
1094477414 12:30851912-30851934 TCTGATTTGCATAGAGCTGTAGG - Intergenic
1094614342 12:32022706-32022728 TCTGAATTGCATAGGGCTCAGGG - Intergenic
1094727351 12:33133826-33133848 TTTGATTTGCATAGCGCTCAGGG + Intergenic
1095573198 12:43705633-43705655 TCTGTTTTTCATACGGCTCAGGG - Intergenic
1095858391 12:46887206-46887228 GCTGAAGTGCAGAGGGCACAAGG + Intergenic
1096045265 12:48556728-48556750 TCTGATTTGCATAGGGCTTAGGG + Intergenic
1096370326 12:51063957-51063979 TCTGATTTACAGAGGGCAGCTGG + Exonic
1098167634 12:67714544-67714566 TCTCATTTGCACAGGGCTCAGGG - Intergenic
1098307423 12:69115956-69115978 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1098679651 12:73336266-73336288 TCTTATTAATATAGGGCACATGG - Intergenic
1098720252 12:73888655-73888677 TCTAATTTACATAGGGCACAAGG + Intergenic
1098972680 12:76872664-76872686 TCTGATTTACATAGGGCTTAGGG - Intronic
1100189636 12:92176880-92176902 TCGGATTTACGTAGGGCCCATGG - Intergenic
1100406676 12:94277955-94277977 TCTGATTTGCCTAGGGCTCAGGG - Exonic
1101480359 12:105090641-105090663 CCTGATTTGTATAGGGCTCAGGG - Intergenic
1101808844 12:108090607-108090629 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1104187587 12:126447700-126447722 TCTGATTTGCATAGGGCTTAGGG - Intergenic
1104351174 12:128045207-128045229 TCTGATTTACACAGGACTCAAGG + Intergenic
1105924810 13:24998292-24998314 TCCGGTTTGCACAGGGCCCAGGG - Intergenic
1106470989 13:30054043-30054065 TCTGTTTTGCATAGGGCTCAGGG + Intergenic
1106472661 13:30071395-30071417 TCTGATTTGTACAGGGCTCAGGG + Intergenic
1106622922 13:31388799-31388821 TCTGATTTGGATAGGGGTCAGGG + Intergenic
1106699099 13:32209779-32209801 TCTGACTTGCAAATTGCACATGG - Intronic
1107033987 13:35881568-35881590 ACTGATTTGCACAGCACACATGG + Intronic
1107080306 13:36367415-36367437 TTTGATTTGCATAGGGCTCAGGG - Intronic
1107620131 13:42218807-42218829 TCTGATTTAAATAGGTCACCAGG - Intronic
1108397020 13:49999291-49999313 GGTGATTTACATAGGGCCCAGGG - Intronic
1109274348 13:60287022-60287044 TCTGATTTGCACAGGGCTCAGGG - Intergenic
1109530809 13:63644030-63644052 ACTGATTGGCATAGGCCAAATGG - Intergenic
1109682298 13:65768685-65768707 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1110332152 13:74285074-74285096 ATTGATCTTCATAGGGCACATGG + Intergenic
1110636111 13:77768489-77768511 TCTGATTTACATAAGGCCCAGGG - Intergenic
1110952649 13:81515863-81515885 TTTGATTTGCATAGGGCTCAGGG + Intergenic
1110963382 13:81659090-81659112 TCTGATTTACATAGAGCCCACGG + Intergenic
1111251642 13:85608796-85608818 TCTGATTTGCATAGGGCTAAGGG - Intergenic
1111301284 13:86354128-86354150 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1111340738 13:86882417-86882439 TCTGCTTTGCATAGGGCTCAGGG - Intergenic
1112089026 13:96062969-96062991 TCTGATTTGTATAGAGCATGAGG + Intergenic
1112170359 13:96966710-96966732 TCTGATTTGCATAGGGCCCAGGG - Intergenic
1112237684 13:97651013-97651035 TTTGATTTGCATAGGGCTCAGGG + Intergenic
1112977461 13:105338558-105338580 TCTGATTAGCATCTGGTACATGG + Intergenic
1113129859 13:107023658-107023680 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1113222454 13:108120590-108120612 TTTGATTTGCATAGGGCTCAGGG - Intergenic
1114131473 14:19798298-19798320 TCTGATTTGCATAGGGCCCAGGG + Intronic
1114293561 14:21308811-21308833 TCTGATTTGCATAGGGCTCAGGG + Intronic
1116301130 14:43184769-43184791 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1116904425 14:50391282-50391304 TCTGATTTGCATATGACACATGG - Intronic
1117754926 14:58964879-58964901 ATTGATTTACATAGGGCCCAGGG - Intergenic
1117969769 14:61240327-61240349 TCTGATTTGCACAGGGCTCAGGG + Intronic
1118654100 14:67928459-67928481 TCTGATTTGCATACAGCCCAGGG + Intronic
1120395497 14:83962405-83962427 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1120425428 14:84341588-84341610 TCTGATTTGCACAGGGCTCAGGG - Intergenic
1120876067 14:89377080-89377102 TCTGACTTCCATGGGACACAAGG + Intronic
1121199948 14:92108477-92108499 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1121239857 14:92421357-92421379 ACTAATTGGCAAAGGGCACAAGG - Intronic
1122078479 14:99250982-99251004 TCTGGTTTGCACAGTTCACATGG + Intronic
1123574534 15:21654001-21654023 TCTGATTTGCATAGGGCCCAGGG + Intergenic
1123611148 15:22096497-22096519 TCTGATTTGCATAGGGCCCAGGG + Intergenic
1123817445 15:23994323-23994345 TCTGATTTGCGTAGGGCTCAAGG + Intergenic
1125050718 15:35295263-35295285 TCTGATTTCCATAGGGTCCAAGG - Intronic
1125070529 15:35548036-35548058 TCAGATTTGCATAGGGCTCAGGG + Intergenic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1126885523 15:53145212-53145234 TCTGGTCTGCTTAGGGAACAGGG + Intergenic
1129339054 15:74873148-74873170 TCAGATTTCCCTAGGGCCCACGG - Intronic
1129568868 15:76656601-76656623 TCTCATCTGCACAAGGCACATGG + Intronic
1129582732 15:76830197-76830219 TCTGATTTACATGGGGCAGAAGG + Intronic
1130263939 15:82381584-82381606 TCTGATTTGCACAGGGACCAGGG - Intergenic
1130277091 15:82486007-82486029 TCTGATTTGCACAGGGCCCAGGG + Intergenic
1130469453 15:84213357-84213379 TCTGATTTGCACAGGGCCCAGGG + Intergenic
1130476943 15:84327921-84327943 TCTGATTTGCACAGGGCCCAGGG + Intergenic
1130494822 15:84460209-84460231 TCTGATTTGCACAGGGCCCAGGG - Intergenic
1130535033 15:84778343-84778365 TTTGATTTGCATAGGGCTCAGGG + Intronic
1130591747 15:85217986-85218008 TCTGATTTGCACAGGGCCCAGGG + Intergenic
1130706340 15:86236788-86236810 TCTGATTTGCATAGGGCTCAGGG + Intronic
1131063867 15:89421019-89421041 TGTGATCTGCATGGGGCACCAGG + Intergenic
1131586958 15:93705606-93705628 TCTCATTTGCATAATGCAGATGG - Intergenic
1131737567 15:95350119-95350141 ACTGAGTTGCTTAGGGCATAAGG - Intergenic
1132214305 15:100051349-100051371 TCTGCTTTGCCTGGGGCCCAGGG - Intronic
1132265082 15:100462973-100462995 ACTGAATTACTTAGGGCACAAGG + Intronic
1202983397 15_KI270727v1_random:388253-388275 TCTGATTTGCATAGGGCCCAGGG + Intergenic
1133543143 16:6775820-6775842 ACTGATTTTCATAAGACACATGG - Intronic
1133630278 16:7613907-7613929 TCAGATTGGCATTGGGCTCAGGG + Intronic
1133631347 16:7625065-7625087 TCTGATTTGCATACAGCCCAGGG + Intronic
1133650940 16:7814153-7814175 TCTGATTTGCATGAGGCTCAGGG - Intergenic
1134376365 16:13678534-13678556 TCTGACTTGCATAGGGCTCAGGG + Intergenic
1134659211 16:15971176-15971198 TCTGATTTGCATAGGCCTCAGGG + Intronic
1136351179 16:29709136-29709158 TCTAATTTGCATAGGGCTTAGGG - Intergenic
1136352367 16:29719294-29719316 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1138817352 16:60217823-60217845 TTTGATTTGCGTAGGGCTCAGGG + Intergenic
1139096877 16:63715181-63715203 TCTGATTTACATAGGGCACAAGG - Intergenic
1140426767 16:74867644-74867666 TCTGATTTACGTAGCGCCCACGG - Intergenic
1141770375 16:86086094-86086116 TCTGATCTGCAAAGTCCACAGGG - Intergenic
1143299030 17:5895492-5895514 TCTGATTTGCACAGGGCTCGGGG - Intronic
1143370782 17:6437738-6437760 TCTGATTTCCATAGGGCCCAGGG - Intergenic
1144012353 17:11161746-11161768 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1144127976 17:12220547-12220569 TCTGATTTGCATAGGGCCCAGGG + Intergenic
1144150613 17:12439763-12439785 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1144593645 17:16546429-16546451 TTTGATTTGCATAGGGCTCAGGG - Intergenic
1144852941 17:18253207-18253229 TCTGACTTGCACAGACCACAAGG + Intronic
1145833636 17:27937373-27937395 TCTGATTTGCATAGGGCTTAGGG - Intergenic
1147870528 17:43583944-43583966 TATGATATGCTTAGGGCTCAGGG - Intergenic
1148014550 17:44512002-44512024 TTTGATTTGCATGGGACTCAGGG - Intergenic
1149046710 17:52254955-52254977 TCTGATTTGCACAGGGCCCAGGG + Intergenic
1149207679 17:54267286-54267308 TTTGATTTGCATAGGGCTCAGGG + Intergenic
1151506660 17:74532333-74532355 CCTGATTTGCATAGGGCCCAGGG - Intergenic
1152064515 17:78103098-78103120 TCTGGTTTGCAAAAGGCACCTGG - Intronic
1152985816 18:319821-319843 GCTGATTTTCATTGTGCACATGG - Exonic
1153170526 18:2311155-2311177 TCTAGTTTGCATAAGGCCCAGGG - Intergenic
1154005446 18:10523620-10523642 TCTGGTTTGCATAGGGCCCAGGG + Intergenic
1154178568 18:12108814-12108836 TCAGACTTGCATGGGGCCCATGG - Intronic
1155613467 18:27695301-27695323 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1155934412 18:31740279-31740301 TCTGATTTGCATAGGGCCCAGGG + Intergenic
1155934980 18:31744413-31744435 TCTGATTTGCACAGGGCCCAGGG + Intergenic
1155943810 18:31825814-31825836 TCTGATTTGCATAGGGCTCAAGG + Intergenic
1156784822 18:40897991-40898013 TCTGATTTACATAGGGCCCAGGG + Intergenic
1157740659 18:50089970-50089992 TTTGATTTGCATAGGTCTCAGGG - Intronic
1157891064 18:51418396-51418418 TTTGATTTACATAGGGCCCAGGG - Intergenic
1157927292 18:51780343-51780365 ACTGATTTACTTAGGGCTCATGG - Intergenic
1158089496 18:53694139-53694161 TCTGATTTGCACAGGGCTTAGGG + Intergenic
1161366394 19:3882086-3882108 TCGGGTTTGCATCGGGGACAGGG - Intronic
1162864811 19:13537770-13537792 TCTGATTTGCATAGGGCCCAAGG - Intronic
1163070616 19:14837635-14837657 TCTGATTTACATAGGGCCCAGGG - Intergenic
1164061616 19:21680268-21680290 ATTGATTTACATAGGGCCCAGGG - Intergenic
1164064646 19:21705504-21705526 ATTGATTTACATAGGGCCCAGGG + Intergenic
1164397289 19:27877294-27877316 TCTGATTTGCATATGAACCAGGG - Intergenic
1164460934 19:28446769-28446791 CCTGATTTGCATAGGGCTCAGGG - Intergenic
1165112479 19:33510445-33510467 TCTGATTTACATAGGGCTCAGGG + Intronic
1165271577 19:34712136-34712158 ATTGATTTACATAGGGCCCAGGG - Intergenic
1165975317 19:39671324-39671346 TCTGGTTTCCATAGGGCCCAGGG - Intergenic
1166411552 19:42558720-42558742 TCTGATTTGCACAGGGCTCAGGG - Intronic
1166964116 19:46517581-46517603 GGTGATCTGCACAGGGCACAGGG - Intronic
1167399422 19:49255166-49255188 TCGGATTTGCAAAGGTGACAGGG + Intergenic
1168183166 19:54677450-54677472 TCTGGTTTGCATAGGGCCCAGGG - Intronic
925841547 2:7996707-7996729 TCTGATTTGATTAAGGGACAAGG + Intergenic
926553419 2:14328512-14328534 TCTGATTTGTATTGTGAACATGG + Intergenic
927213901 2:20655332-20655354 GCTCCTTTGCATAGCGCACAAGG - Intergenic
928057343 2:28071083-28071105 TGTGATTGGGATGGGGCACATGG - Intronic
928843604 2:35641568-35641590 TCTCATTGGCAGAGAGCACAGGG + Intergenic
930438260 2:51374549-51374571 TCTGAGTAGCAGAGAGCACAGGG - Intergenic
930621332 2:53646881-53646903 TCTGATTTGCATAGGGCCCAGGG + Intronic
930869931 2:56160190-56160212 TCTGATTTGCACAGGGCTCAGGG - Intergenic
931345764 2:61444736-61444758 TCTGATTTGCATAGGGCTCAGGG - Intronic
934028967 2:88024594-88024616 TCTGGTTTCCATAGGGCCCAGGG + Intergenic
934126118 2:88892516-88892538 TGGGATTTGCATAGGGGATAGGG - Intergenic
934131502 2:88953311-88953333 TCTGATTTGCATAGGGCTTAGGG - Intergenic
934135775 2:88995113-88995135 TCTGATTTGCAAAGGGCTCAAGG - Intergenic
934147026 2:89104964-89104986 TCTGATTTATATAGGGCTCTAGG - Intergenic
934166115 2:89295961-89295983 TCTGATTTGCACAGGGCTCAGGG + Intergenic
934201160 2:89886495-89886517 TCTGATTTGCACAGGGCTCAGGG - Intergenic
934222240 2:90095631-90095653 TCTGATTTATATAGGGCTCTAGG + Intergenic
934233175 2:90205401-90205423 TCTGATTTGCATAGGGCTCAGGG + Intergenic
934234540 2:90218662-90218684 TCTGATTTGCAAAGGGCTCAAGG + Intergenic
934688097 2:96336031-96336053 TCTGATTGGCTGAGCGCACAAGG - Intronic
934983709 2:98869197-98869219 TCTGAGTGGCCTAGGGCCCACGG + Intronic
935162079 2:100537937-100537959 TCTGATTTGCATAGGGCTCAGGG + Intergenic
935251280 2:101263801-101263823 TCTAAATTGCATAGGTCACCAGG + Intronic
935461068 2:103334947-103334969 TCTGATTTGCATAGCACTCAGGG + Intergenic
936229627 2:110688750-110688772 TCTTATTTGCCTAGGGCCCAGGG - Intergenic
936685363 2:114821138-114821160 TCTGATTTGCATAGGGCTCACGG + Intronic
937169736 2:119854063-119854085 TCTGATTTGCATAGGGCTCAGGG + Intronic
937838462 2:126498190-126498212 TCTGATTTACACAGGGCCCAGGG + Intergenic
938421388 2:131150125-131150147 TCTCATATGCACACGGCACAGGG - Intronic
939133899 2:138271776-138271798 TCTGATTTGCATAGGACTCAGGG - Intergenic
939477689 2:142707537-142707559 TTTGATTTGCATAGGACCCAGGG + Intergenic
941608342 2:167628925-167628947 AGTTACTTGCATAGGGCACATGG + Intergenic
942990678 2:182197765-182197787 TGTTATTGGCATAGGGCATAGGG - Intronic
943446010 2:187988654-187988676 CCTGATTTGCATAGAGCCCAGGG - Intergenic
943446740 2:187995780-187995802 TCTGATTTGCATAGGGCTCTGGG - Intergenic
943618360 2:190119358-190119380 TCTGATTTGCATAGGGCTCAGGG + Intronic
943668697 2:190637689-190637711 TCTGGTTTGGGTAGGGCAGAGGG - Intergenic
943750386 2:191504090-191504112 TTTGATTTGCGTAGGGCTCAGGG + Intergenic
944477873 2:200125644-200125666 TCTGATTTATACAGGGCTCAAGG + Intergenic
944701465 2:202249986-202250008 TTTCATTTGCATAGGGCTTAGGG + Intergenic
944748070 2:202678345-202678367 TTTGATTTGCATAGGGCTCAGGG + Intronic
945954313 2:216071382-216071404 TCTGATTAACAGAAGGCACATGG + Intronic
947267540 2:228300059-228300081 TTTGATTTGCATAGGGCTCAGGG + Intergenic
947268722 2:228309022-228309044 TTTGATTTGCATAGGGCTCAGGG + Intergenic
947282729 2:228473496-228473518 TCTGATTTACACAGGGCCCAAGG + Intergenic
947598460 2:231429236-231429258 TTTGATTTGCATAGGGCTCAGGG + Intergenic
948309583 2:236975003-236975025 CCTGATTTGCGTAGGGCTCAGGG - Intergenic
1170101161 20:12701021-12701043 TCTGATTTGCATAGGGCCCAGGG - Intergenic
1170421905 20:16201385-16201407 TCTGATTTGCATAGGACTCAGGG - Intergenic
1171128825 20:22629177-22629199 TCTGATTTCAATAGGCCAAATGG - Intergenic
1171288131 20:23959779-23959801 ACGTATTTGCATAGGGCAGAAGG + Intergenic
1172889009 20:38250695-38250717 TCTGATTTGCATAGGGCTCAAGG + Intronic
1173467653 20:43296053-43296075 TCTGATTTGCATAAGGCTCAGGG - Intergenic
1174056948 20:47804531-47804553 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1174489769 20:50884628-50884650 TCTGGTTTTCATATGGCACAAGG + Intergenic
1174660567 20:52209283-52209305 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1175043571 20:56079811-56079833 TCTTATTTACCTTGGGCACATGG + Intergenic
1176668805 21:9712677-9712699 TCTGCTTTCCCTAGGGCTCATGG - Intergenic
1176675398 21:9772517-9772539 TCTGATTTCCTTAGGGCTCAGGG + Intergenic
1177332702 21:19683037-19683059 TCTGATTTGTATAGGGTTCAGGG - Intergenic
1177716124 21:24841437-24841459 TCTGATTTGCATAGGGCCCAAGG + Intergenic
1178325409 21:31641594-31641616 TCTGATTTGCACAGGGCTCAGGG + Intergenic
1179077965 21:38141888-38141910 TTTGATTTGCATATGGCATTTGG - Intronic
1179161804 21:38905503-38905525 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1179862816 21:44199715-44199737 TCTGGTTTGCATAGGGGGCAGGG - Intergenic
1181376207 22:22460158-22460180 TCTGATTTGCAAAGGGCCCAGGG + Intergenic
1181376793 22:22465156-22465178 TCTGATTTGCACAGGGCCCAGGG + Intergenic
1181641909 22:24205874-24205896 TTTGATCTGCATAAGGCCCAGGG + Intergenic
1181682859 22:24507913-24507935 TCTGATTTGCATAGGGCCCAGGG - Intronic
1181861455 22:25822383-25822405 TCTGTTTGGCAGAGGGCAGAGGG + Intronic
1182670071 22:31988364-31988386 TCTGGTCTGCATAGGGCCCAGGG + Intergenic
1182913313 22:34005714-34005736 TCAGATATGCATAGGGCCTATGG - Intergenic
1183037673 22:35152391-35152413 TCTGATTTGCATAGGCCTCAGGG + Intergenic
1183282676 22:36940760-36940782 TCTGATTTGCATAGGGCTCAGGG + Intergenic
949669186 3:6378516-6378538 TCTAATTTGCACAAGGCCCAGGG - Intergenic
949684562 3:6553418-6553440 TTTGATTTGCATAGGGCTCAGGG - Intergenic
951346410 3:21551607-21551629 ACTAATTTGCCTAGGTCACATGG + Intronic
952962320 3:38600167-38600189 TCTAATCTTCATAGGGCAGAGGG + Intronic
953076614 3:39577609-39577631 TCTGGTTTGCATAGGGCTCAGGG + Intergenic
953760708 3:45684632-45684654 TTTGATTTACATAGAGCCCAAGG + Exonic
954085392 3:48240192-48240214 TCTGGTTTCCATAGGGCTCAGGG + Intergenic
956327186 3:68066917-68066939 ACAGATTTCCATAAGGCACAGGG + Intronic
957274129 3:78068305-78068327 TCTGATTTGCATAGGTCTCAGGG + Intergenic
957478543 3:80759049-80759071 TCTGATTTACATAGGGCCCATGG + Intergenic
957573578 3:81980664-81980686 TCTGTTGTGCATAAAGCACAAGG + Intergenic
958255891 3:91324468-91324490 TCTGATGTGCAAAGTGCAGAAGG + Intergenic
958574262 3:95927159-95927181 TCTGATTTGCATAGGGCTCAGGG + Intergenic
959175525 3:102904701-102904723 CCTGCTTTGCATAGGGCTCAGGG + Intergenic
959341336 3:105135341-105135363 TCTGATTTGTATAGGGCTCAGGG - Intergenic
959822845 3:110757016-110757038 TCTGATTTGCATAGGGCTTAGGG - Intergenic
960682548 3:120264076-120264098 TCTGATTTGCATAGGGCTCAGGG - Intronic
960719973 3:120616264-120616286 TCTGATTTGCACAGGGCTCAGGG + Intergenic
962458891 3:135590960-135590982 TCTGATTTGCATAAAGCTCGGGG - Intergenic
963174998 3:142288989-142289011 TCTGATTTATGTAGGGCCCATGG - Intergenic
963226424 3:142867102-142867124 TCTGATTTGCATAGGGCCCAGGG - Intronic
964195783 3:154062771-154062793 TCTGATTTGCATAGGGCTCAGGG - Intergenic
964238293 3:154560676-154560698 TCTGACTTGCATAGAGCACATGG - Intergenic
965099414 3:164277528-164277550 TCTGATTTGCACAGGGCTCAGGG + Intergenic
965370049 3:167850984-167851006 TCCAATTTGTATAGCGCACAAGG + Intergenic
965819058 3:172666384-172666406 TCTGGTTTGCATAGGGCCCAGGG - Intronic
965820097 3:172676513-172676535 TCTGGTTTGCATAGGGCCCAGGG - Intronic
966456884 3:180127799-180127821 TCTGATTTGTATAGGGCTCAGGG + Intergenic
967542613 3:190684963-190684985 TCAGTTTTGCATAGGGCAAGGGG - Intergenic
967747136 3:193069750-193069772 TCTGAATTGCATAGGTGAGAAGG - Intergenic
968005911 3:195242657-195242679 TCTGATCTGCATAGGGCCCAGGG + Intronic
968171998 3:196518226-196518248 TCTGATTTGCATAGAGCCCAAGG - Intergenic
969337654 4:6521223-6521245 GCAGGTTTGCCTAGGGCACAGGG - Intronic
969925330 4:10579909-10579931 CCTGATTTGCATAGGGTTTAGGG - Intronic
970570203 4:17373332-17373354 TCTAATTTGGATAATGCACATGG + Intergenic
972216327 4:36900788-36900810 TCTGATTTGCATAGGGCTCAGGG - Intergenic
972783990 4:42310439-42310461 TCTGACTTGGGTAGGGCTCAGGG + Intergenic
973785616 4:54330068-54330090 TCTGAATTCCAGAGGGAACAGGG - Intergenic
974332211 4:60495603-60495625 TCTGATTTGCATAGGGCCCAGGG + Intergenic
974424495 4:61723523-61723545 TCTGATTTGCATAGGGCCCAGGG + Intronic
974648069 4:64719132-64719154 TCTGATTTGCATAAGGCCCAGGG + Intergenic
974914006 4:68157194-68157216 TCTGATTTGCATAGGACCCAGGG + Intergenic
974933776 4:68389568-68389590 TCTGATTTGTATAGGGCTCAGGG + Intergenic
975310435 4:72897981-72898003 TTTGATTTGCATAGGGCCTAGGG + Intergenic
975730152 4:77329924-77329946 TCTGATTTGCATAGGGCTCAGGG + Intronic
976097594 4:81526131-81526153 TGTGATTAGCATATGGGACATGG + Intronic
976194955 4:82523322-82523344 TTTGATTTGCATAGGGCTCAGGG + Intronic
976267220 4:83195619-83195641 TCTGATTTGCATAGGGCTCAGGG - Intergenic
977751950 4:100620454-100620476 TCTGATTTGCACAGGGCTCAGGG + Intronic
978498807 4:109386920-109386942 TCTGATTTGCATAGGGTCCATGG + Intergenic
978522959 4:109635563-109635585 TCTGATTTGCATAGGGCACAGGG - Intronic
978945890 4:114495639-114495661 TCTGATCTGCATAGGGCTTAGGG + Intergenic
979882981 4:125986174-125986196 TCTGATTTGCATAGGGCTCAGGG - Intergenic
980480092 4:133376931-133376953 TCTGATTTGCATAGGGCTCAGGG + Intergenic
980600842 4:135022251-135022273 TTTGATTTGCATAGGGCCCAGGG - Intergenic
981403362 4:144339727-144339749 TCTGATTTGCATAGGGCTCAGGG + Intergenic
981893954 4:149774581-149774603 TCTGATTTGCATAGGGCTCAGGG - Intergenic
981980364 4:150784576-150784598 TCTGATTTGCATAGGGCTCAGGG - Intronic
982429425 4:155305682-155305704 TTTGATTTGCATAGAGCTCAGGG + Intergenic
982919133 4:161251996-161252018 TCTGGTTTGCATAGGGCTCAGGG + Intergenic
983043152 4:162954410-162954432 TCTGGTTTGCATAGGGCCCAGGG + Intergenic
983164830 4:164462433-164462455 TCTGATTTCAAAAGGTCACATGG - Intergenic
983412278 4:167416781-167416803 TCTGATTTACACAGGGCCCAGGG - Intergenic
983413208 4:167424152-167424174 TCTGATTTACCTAGGGCCCAGGG - Intergenic
983515407 4:168650811-168650833 TATGATATGCATAGGGCAAGAGG - Intronic
983768142 4:171512630-171512652 TCTGATTTGCATAGGGCTCAGGG - Intergenic
983775206 4:171597934-171597956 TCTGATTTGCATAGGAGTCAGGG + Intergenic
984050098 4:174855364-174855386 TTTGATTTGCACAGGGCTCAGGG - Intronic
984083346 4:175277846-175277868 ACTGATTTACATAGGGCCCAGGG + Intergenic
984367789 4:178821028-178821050 TCTGATTTGCACAGGGCTCAGGG + Intergenic
984862259 4:184251733-184251755 TCTGATTTGCATAGGGCTCAGGG + Intergenic
984941528 4:184936374-184936396 TTTGATTTGCACAGGGCTCAGGG - Intergenic
985044299 4:185924696-185924718 TCTGATTTGCATAGGGCACAGGG - Intronic
985400152 4:189586180-189586202 TCTGATTTCCATAGGGCTCAGGG - Intergenic
985793050 5:1941791-1941813 GCTGATTTGCTTTGGGCAGAAGG + Intergenic
986576177 5:9215089-9215111 TCTGCTTTGCCCAGGGCAGAGGG - Intronic
986825190 5:11512710-11512732 GCTGATTTACATAGGGCTCCAGG + Intronic
986892938 5:12331312-12331334 TCTAATTTGCATAGGGCTCAGGG - Intergenic
986948535 5:13053229-13053251 TCTTATTTGCACAGGGCCCAGGG - Intergenic
987017504 5:13835656-13835678 TCTGATTTGCATAGGGCTTAGGG - Intronic
987507994 5:18798168-18798190 TCTGATTTGCCTAGGGCTCAGGG + Intergenic
987509018 5:18811649-18811671 TCTCATTTGAATAGAGCAAAAGG + Intergenic
987525766 5:19047333-19047355 TCTGGTTTGCACAGGGCTCAGGG + Intergenic
987668379 5:20975406-20975428 TCCGGTTTGCATAGGGCCCAGGG + Intergenic
987842060 5:23234529-23234551 TCTGATTTGCATAGAATTCAGGG - Intergenic
988016875 5:25570474-25570496 TTTGATTTGCATAGGGCTCAGGG - Intergenic
988523334 5:31965306-31965328 TCTGATTTGCATAGGGCACAGGG + Intronic
988584988 5:32500440-32500462 TTTGATTTGCATAGGGCTCAGGG - Intergenic
988856638 5:35233712-35233734 TTTGATTTGCCTAGGGCTCAGGG + Intergenic
989214289 5:38888158-38888180 TCTGATTTGCATAGGGCTGAGGG + Intronic
989282021 5:39655297-39655319 TCTGATTTACACAGGGCTTAGGG - Intergenic
992452881 5:76889074-76889096 CTTGATTTGCATAGGGCTCAGGG - Intronic
992616228 5:78548436-78548458 TCTGATTAGCAGATGTCACAGGG - Intronic
993247155 5:85465591-85465613 TCTGGTTTGCATAGGGTTCAGGG - Intergenic
994089979 5:95801161-95801183 TCTGGTTTGCATAGGGCCCAGGG - Intronic
994741831 5:103628604-103628626 TTGGATTGGGATAGGGCACATGG - Intergenic
995714902 5:115072751-115072773 TCTGATTTACATAGGGCCCAGGG + Intergenic
995738556 5:115329691-115329713 TCTGATTTGCATAGGACTCAGGG - Intergenic
997163958 5:131638388-131638410 TATGATCAGGATAGGGCACATGG + Intronic
997192271 5:131948194-131948216 GATGATTGGCATAGGGAACATGG + Intronic
998345116 5:141455492-141455514 TCTGATTTGCATAGGGCTCAGGG + Intronic
1000068689 5:157719332-157719354 TTTGATTTGCACAGGGCTCAAGG + Intergenic
1000095283 5:157966256-157966278 TTTAATTTGCATAGGTCTCAGGG - Intergenic
1000276574 5:159741972-159741994 TTTGATTTGCATAGGGCTCAGGG + Intergenic
1000884829 5:166739333-166739355 TCAGATTCCCATGGGGCACATGG + Intergenic
1001298860 5:170519007-170519029 TCTGACTTGCCTAGAGCAGAGGG - Intronic
1003255403 6:4470845-4470867 TCTGATTTGCGTAGGGCTCAGGG + Intergenic
1003304564 6:4914699-4914721 TTTGGTTTGCATAGAACACAGGG + Intronic
1004322427 6:14642527-14642549 TCTGATTTGAATGTGGCAAATGG + Intergenic
1005047244 6:21653965-21653987 TTTGATTTGCATGGGGCTCAGGG + Intergenic
1005119980 6:22379142-22379164 TTTGATTTGCGTAGGGCTCAGGG - Intergenic
1005286079 6:24328424-24328446 TCTGAATATCTTAGGGCACAGGG + Intronic
1005982232 6:30845269-30845291 TCTGATCTGCATAGGACTCAGGG + Intergenic
1006289610 6:33124597-33124619 ATTGATTTACATAGGGCTCAGGG + Intergenic
1006676060 6:35764552-35764574 TCTGATTTGCATAGGGCCCAGGG + Intergenic
1007082240 6:39115849-39115871 ACTGATTGGGAGAGGGCACAAGG - Intergenic
1008051319 6:46902908-46902930 CCTGATTTGAATAGAGCAAATGG + Intronic
1008083732 6:47221847-47221869 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1008561860 6:52731969-52731991 TCTGATTTGCACAGGGCTCAGGG - Intergenic
1008845426 6:55957470-55957492 TCTGATTTGCATAGGGCCCAGGG + Intergenic
1008999450 6:57696705-57696727 TCTGATGTGCAAAGTGCAGAAGG - Intergenic
1009187936 6:60596109-60596131 TCTGATGTGCAAAGTGCAGAAGG - Intergenic
1009529027 6:64786376-64786398 TCTGATTTGCATAGGGCTCAGGG + Intronic
1009644082 6:66374252-66374274 TCTGCTTTGCCTAGAGCATATGG + Intergenic
1009683746 6:66929505-66929527 TCTGATTTGCATAAGGCCCAGGG - Intergenic
1010368555 6:75080903-75080925 GCTGATTTTCATGGGGTACATGG - Intergenic
1010368635 6:75081691-75081713 GCTGATTTTCATGGAGCACATGG + Intergenic
1010648579 6:78424235-78424257 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1011722422 6:90171476-90171498 TTGGATTTGGAAAGGGCACATGG - Intronic
1011847359 6:91582649-91582671 TATGTTTTGAATAGGGCAAAAGG - Intergenic
1011876350 6:91966480-91966502 TCAGACTTGCATGGGGCCCATGG + Intergenic
1014197919 6:118580067-118580089 TCTGATTTGCATAGAGTCCAGGG - Intronic
1015889479 6:137955312-137955334 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1016181003 6:141148560-141148582 TATGATTTGCACAGAGCTCAGGG + Intergenic
1016236237 6:141870357-141870379 TCATATTTACATAGGGCATAGGG - Intergenic
1016733184 6:147448491-147448513 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1017428210 6:154344049-154344071 TCTGATTTGCATAGGGCTCAGGG - Intronic
1017863592 6:158422728-158422750 TCAGATTTGCATAGGGCTCAGGG + Intronic
1018190886 6:161308228-161308250 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1018366285 6:163123155-163123177 TCTGATTTGCTTAGGGCCCAGGG + Intronic
1018926263 6:168209125-168209147 TCTGGTTTGCATAAGGCCGAGGG - Intergenic
1020350165 7:7210605-7210627 TTCGATTTGCATAGGGCTCCGGG + Intronic
1020651529 7:10882408-10882430 TGATATTTGCATAGGGCCCAGGG - Intergenic
1020773408 7:12424178-12424200 TCTGATTTGCATAGGGCCCAGGG + Intergenic
1020851909 7:13364282-13364304 TTGGATTTGCATAGGACTCAGGG - Intergenic
1021069021 7:16214311-16214333 TCTCATTTGGCTAGGGCAAAAGG - Intronic
1021176998 7:17460725-17460747 TCTGATTTGCATAGGGCCCAGGG + Intergenic
1021412703 7:20346324-20346346 TATGAATTTCAGAGGGCACAGGG + Intronic
1021574762 7:22096914-22096936 CCTGATTTCCATAGGGCTTAGGG - Intergenic
1021946486 7:25732816-25732838 TCTGATTTGCATGGGGCTCAGGG + Intergenic
1022279325 7:28890234-28890256 TCTGATTTGCATAGGGTCCAGGG + Intergenic
1022336756 7:29429127-29429149 TGTGATATGCATAGGGCAAGAGG - Intronic
1023734000 7:43219016-43219038 TTTGATTTGCATAGGGCTCAGGG + Intronic
1023782457 7:43669577-43669599 CCTGATTTGCATAGCGCTCAGGG - Intronic
1023819672 7:43973490-43973512 TCTGCTCTGGATGGGGCACAGGG + Intergenic
1024090910 7:45939139-45939161 TCTGACGTCCACAGGGCACAGGG - Intergenic
1024770172 7:52713168-52713190 TCTGATTTACATAAGGCCCAGGG - Intergenic
1024865373 7:53899919-53899941 TCTGATTTGCACAGGGCTAAGGG - Intergenic
1025009353 7:55383367-55383389 TCTGATTTACATAGGGCCCAGGG + Intronic
1025236064 7:57235647-57235669 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1026201748 7:68220463-68220485 TCTGATTTACACAGGGCTCACGG - Intergenic
1026369324 7:69683124-69683146 TCTGATTTGTATAGGGCCCAGGG + Intronic
1026654009 7:72240820-72240842 TCTGATTTGTATAGGTCACTTGG - Intronic
1028243565 7:88449582-88449604 TCTGGTTTGCATAGGGCTCAGGG - Intergenic
1028252021 7:88547881-88547903 TCTGATTTATGTAGGGCTCATGG + Intergenic
1028589250 7:92478997-92479019 TCTGATTTGCACAGGGCCCAGGG - Intergenic
1029333883 7:99883581-99883603 TCTGATTTTCATAGGGCCCATGG + Intronic
1029744721 7:102510459-102510481 TCTGCTCTGGATGGGGCACAGGG + Intronic
1029762712 7:102609621-102609643 TCTGCTCTGGATGGGGCACAGGG + Intronic
1030407129 7:109128959-109128981 TCTGGTTTCCATAGGGCCCAGGG + Intergenic
1030782332 7:113617054-113617076 TCTGATTTACATAGGGCCCAAGG - Intergenic
1031410630 7:121436847-121436869 TCTGATTTGCATAGGACTCAGGG + Intergenic
1033221197 7:139527058-139527080 CTTGATGTGCATTGGGCACATGG - Intronic
1033817003 7:145085315-145085337 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1034020842 7:147640863-147640885 CCTGACTTGCATAGGGCTCAGGG + Intronic
1034736163 7:153431317-153431339 TCTGATTTGCATAGTGCTCAGGG - Intergenic
1034872699 7:154697568-154697590 TCTGTTTGGCAGAGGTCACATGG + Intronic
1034880588 7:154759539-154759561 CCGGATTTGCATAAGGCTCAGGG - Intronic
1037102968 8:15070560-15070582 TAAGAATTGCATAGGGCCCATGG + Intronic
1038873583 8:31522633-31522655 TCTGATTTGCACAGGGCTCGGGG + Intergenic
1039649922 8:39330233-39330255 TCTAATTTACGTAGGGCCCAGGG + Intergenic
1039713860 8:40087702-40087724 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1039731746 8:40286985-40287007 TCTGAATTGGATTGGACACATGG + Intergenic
1040401719 8:47057151-47057173 TCTGATTTGCATAGGGTCCAGGG + Intergenic
1040673307 8:49718010-49718032 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1040801775 8:51350246-51350268 ATTGATTCGCATAGGGCCCAGGG + Intronic
1040854734 8:51937031-51937053 TCTGATTTACATAGGGCCCAAGG + Intergenic
1040988122 8:53318533-53318555 TCTGGTTTGTATAGGGCTCAGGG - Intergenic
1041182235 8:55260709-55260731 TCACATTTGCATAGTGCATAGGG + Intronic
1041536246 8:58928265-58928287 CCTGATTTCCATAGCACACAAGG - Intronic
1041741816 8:61164640-61164662 TCTGATTTGCATAGGGCTCAGGG - Intronic
1041831834 8:62163277-62163299 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1042442878 8:68848432-68848454 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1042710922 8:71716317-71716339 TTTGATTTACATAGGGCATAGGG + Intergenic
1042943572 8:74132104-74132126 TTTGATTTGCATAGAGCTCAGGG + Intergenic
1044136462 8:88592128-88592150 ACTGATTTACATAGGGCTCAGGG + Intergenic
1044433796 8:92138569-92138591 TCTGGTTTGCAGATGACACATGG - Intergenic
1044943983 8:97373759-97373781 TCTACTTTGCACAGGGCACAGGG + Intergenic
1044959627 8:97517765-97517787 TGTGAGGTGCATGGGGCACATGG - Intergenic
1046512890 8:115221528-115221550 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1046744760 8:117864839-117864861 TCTGGTCTGCATGTGGCACAAGG + Intronic
1046825790 8:118690000-118690022 TCTGTTGTGCATAGGACAAAAGG - Intergenic
1046950536 8:120015788-120015810 TCTGATTTGCACAGGGCTCAGGG + Intronic
1047180800 8:122585916-122585938 TCTGATTTCCATTGGCCACTAGG + Intergenic
1047284951 8:123479881-123479903 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1048457083 8:134587893-134587915 CCTGCTATGCACAGGGCACAGGG + Intronic
1050186564 9:2981247-2981269 TCTGGTTTGCACAGGGCCCAGGG - Intergenic
1050620737 9:7449701-7449723 TCTGATGTGGGTTGGGCACAGGG + Intergenic
1050745962 9:8876732-8876754 TCTTATTTGCAAAGGGTACCTGG - Intronic
1051278322 9:15417955-15417977 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1052047263 9:23808887-23808909 TCTGAATTCCATAGGGAACTGGG + Intronic
1052528838 9:29656138-29656160 TCTGATTAACAGAAGGCACAGGG + Intergenic
1052718346 9:32145601-32145623 TCTGGTTTCCATAGGGCCCAGGG - Intergenic
1055505216 9:76941215-76941237 TCTGATTTTCCTGGGGCACTAGG - Intergenic
1055813337 9:80177568-80177590 TCAGATTTGCATAGAGCTTATGG - Intergenic
1056380845 9:86055933-86055955 TCTGATTTCCAGAGGAAACATGG - Intronic
1057760908 9:97873740-97873762 TCTGGTTTGCATAGGTCTCAGGG - Intergenic
1060304864 9:122402361-122402383 GATGATTTGGACAGGGCACATGG - Intergenic
1060330986 9:122670124-122670146 TTTGATTTACATAGGACTCAGGG - Intergenic
1060594566 9:124840476-124840498 TCAGATTTCCACAGGGCACATGG + Intergenic
1203657061 Un_KI270753v1:8264-8286 TCTGCTTTCCCTAGGGCTCATGG + Intergenic
1185862492 X:3592264-3592286 TCTGATTTGCATAGGGCTTAGGG + Intergenic
1186055137 X:5642193-5642215 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1186800092 X:13084034-13084056 TCTGATTTGCACAGGGCTCAGGG + Intergenic
1187292514 X:17968949-17968971 TGTGATATGCCTAGGACACATGG - Intergenic
1188148944 X:26648995-26649017 TGTGATTTGCATAGGGCCCAGGG + Intergenic
1188149540 X:26654435-26654457 TTTGATTTGCATAGGGCCCAGGG + Intergenic
1188429719 X:30092719-30092741 TTTGATTTGCATAGGGCTCAGGG - Intergenic
1188518724 X:31014558-31014580 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1189027227 X:37408358-37408380 TCTGATTTGCATAGGGCTCAGGG + Intronic
1189194432 X:39140782-39140804 TCTCATTTACATAGGACACTGGG - Intergenic
1189590393 X:42505131-42505153 TCTGATTTGCATAGGGCTCTGGG + Intergenic
1190466231 X:50727138-50727160 TCAGATTTGCATTGGGCCTATGG + Intronic
1190538796 X:51456518-51456540 TTTGATTTGCATAGGGCCCAGGG - Intergenic
1190539432 X:51461925-51461947 TCTGATTTGCATAAGGCCCAGGG - Intergenic
1191204170 X:57816773-57816795 TCTAATTTGCATAGGGCCCAGGG + Intergenic
1191204860 X:57822866-57822888 TCTGATTTGCATAGGGTCCAGGG + Intergenic
1191889554 X:65926256-65926278 TCTGGTTTGCATAAGGCTCAGGG + Intergenic
1191936213 X:66429719-66429741 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1192765178 X:74132604-74132626 TCTGATTTGGATAGGGCTCAGGG - Intergenic
1192765775 X:74138256-74138278 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1192777503 X:74260246-74260268 TTTGATTTGCATAGGGCTCAGGG - Intergenic
1192840773 X:74853276-74853298 ATTGATTTACATAGGGCTCAGGG + Intronic
1193353067 X:80484181-80484203 TATGATTTGCACAGTGCTCAGGG - Intergenic
1194104931 X:89757221-89757243 TTTGATTTGCATAGGGCCCAGGG + Intergenic
1194105555 X:89762723-89762745 GTTGATTTACATAGGGCCCAGGG + Intergenic
1194207383 X:91028443-91028465 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1194222562 X:91213706-91213728 TCTGGTTTACATAGGGCCCAGGG + Intergenic
1194476626 X:94366925-94366947 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1194533040 X:95074358-95074380 CCTGATTTGCATAGGGCCCAGGG + Intergenic
1194533648 X:95079586-95079608 CCTGATTTGCATAGGGCCCAGGG + Intergenic
1195336202 X:103857345-103857367 TCTGATTTACATAGGGCCCAGGG + Intergenic
1195920407 X:109977895-109977917 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1196747627 X:119085785-119085807 TCTGATTTGCAGATGGCACCAGG - Intronic
1197209848 X:123819575-123819597 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1197662395 X:129188272-129188294 TCTGATTTGCACAGGGCTCAGGG + Intergenic
1198633808 X:138673306-138673328 TTTGATTTGCATAGGGCTCAGGG + Intronic
1198837203 X:140817479-140817501 TCTTGTTTGCATAGGGCCCAAGG + Intergenic
1198847768 X:140931220-140931242 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1199018629 X:142848689-142848711 TCTGATTTGCATAGGGCGCAGGG - Intergenic
1200425852 Y:3019664-3019686 TCTGATTCGCACAAGGCTCAGGG + Intergenic
1200456895 Y:3405010-3405032 TTTGATTTGCATAGGGCCCAGGG + Intergenic
1200457519 Y:3410548-3410570 GTTGATTTACATAGGGCCCAGGG + Intergenic
1200553183 Y:4603493-4603515 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1200559091 Y:4677471-4677493 TCGGGTTTACATAGGGCCCAGGG + Intergenic
1201356113 Y:13098754-13098776 TCTAATTTGCATAGGGGTGACGG + Intergenic
1201938012 Y:19428321-19428343 CTTGATTTACATAAGGCACAAGG + Intergenic
1202060686 Y:20884743-20884765 TCTGATTTCCATAGGGCTCCGGG - Intergenic