ID: 988525922

View in Genome Browser
Species Human (GRCh38)
Location 5:31987476-31987498
Sequence CATCAGAGGCAGCCTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 448}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988525917_988525922 -2 Left 988525917 5:31987455-31987477 CCTGATGAGCCCTCACGTTTGCA 0: 1
1: 0
2: 0
3: 8
4: 59
Right 988525922 5:31987476-31987498 CATCAGAGGCAGCCTGAGGATGG 0: 1
1: 0
2: 4
3: 32
4: 448
988525916_988525922 -1 Left 988525916 5:31987454-31987476 CCCTGATGAGCCCTCACGTTTGC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 988525922 5:31987476-31987498 CATCAGAGGCAGCCTGAGGATGG 0: 1
1: 0
2: 4
3: 32
4: 448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988525922 Original CRISPR CATCAGAGGCAGCCTGAGGA TGG Intronic
900596532 1:3482638-3482660 CATCTGGGGCAACCTGGGGAGGG + Intergenic
900740077 1:4325758-4325780 CTGCAGGGGCAGCCTGAGGCTGG - Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
902228452 1:15011996-15012018 GAACAGATGCAGCCTGAGGCTGG - Intronic
902931795 1:19736605-19736627 CAGCAGGGGCTGCCTGTGGAGGG - Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
903753119 1:25642177-25642199 TAGCAGAGGCAGCCACAGGAGGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904410854 1:30324008-30324030 CATCAGAGGCAGCCTATGTCTGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
906077490 1:43062893-43062915 CATCAAACGCAGCCTGAGCCTGG + Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907311358 1:53540807-53540829 CATCTGGGGCTGCCTGGGGAGGG + Intronic
907673157 1:56494355-56494377 CATCAAAGGAAGGCTGAGAATGG - Intergenic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908859738 1:68470538-68470560 CATCAGAGGAGGCCTGCAGATGG + Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910602185 1:89043701-89043723 CACCAGAGGGAGGCTGAGGCCGG - Intergenic
911090959 1:94016475-94016497 CAGCAGAGGCAGCTGGAGCAGGG + Intronic
911584939 1:99679805-99679827 TCTCACAGGCAGCCTGAGGCAGG - Intronic
912320713 1:108710152-108710174 AATCAGTGGCTGCCTGGGGATGG - Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913319701 1:117579531-117579553 CCTCAGAGGCAGAGTAAGGAAGG - Intergenic
913978830 1:143489206-143489228 CATCAGAGACTGCCTCAGCATGG + Intergenic
914073236 1:144314855-144314877 CATCAGAGACTGCCTCAGCATGG + Intergenic
914105918 1:144651505-144651527 CATCAGAGACTGCCTCAGCATGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914901461 1:151713385-151713407 GATGAGAGACAGCCTGGGGATGG - Intronic
914914283 1:151809077-151809099 CATCACAGGCAGCTACAGGAGGG + Intronic
915482872 1:156199243-156199265 GATCAGAGGCACCCTGCTGAGGG + Intronic
917009164 1:170451535-170451557 CATTAGTGGGAGGCTGAGGAAGG + Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
918057361 1:181033578-181033600 CATCATAGGGAGCCAGAGCAGGG + Intronic
918279687 1:182991957-182991979 CATCAGAGGCAGTGAAAGGATGG + Intergenic
918301327 1:183206818-183206840 CAACAGAGACAGCCTGTGTAGGG + Intronic
919054000 1:192546127-192546149 GAGCAGATGCAGGCTGAGGAAGG + Intergenic
919464633 1:197913647-197913669 CGTCAGCGTCAGCCTGAGGCTGG - Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922725316 1:227920323-227920345 GATCAGAGGCAGGGTTAGGAGGG + Exonic
1062795885 10:344939-344961 CAGCAGATCCAGCCTGAGCAAGG + Intronic
1063051813 10:2457744-2457766 GAGGAGAGGCACCCTGAGGAGGG + Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064611563 10:17108172-17108194 CATCTGAAGCACCCTGAGGTAGG + Intronic
1065207616 10:23372287-23372309 CATAATATGCACCCTGAGGATGG - Intergenic
1066610639 10:37244610-37244632 CAGCAGAGGTAACCTGATGAAGG - Intronic
1066659030 10:37721368-37721390 CTGCAGAGGCATCCTGGGGAGGG + Intergenic
1067098193 10:43316027-43316049 CATCCCAGGCGGCCTCAGGATGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069114890 10:64492632-64492654 GGTCAGAGGCAGGCAGAGGAAGG - Intergenic
1070394928 10:76003637-76003659 CAGGAGAGGCAGCATTAGGAAGG + Intronic
1070773977 10:79099343-79099365 TTTCAAAGGCAGCCTGGGGAAGG - Intronic
1071385554 10:85116631-85116653 CATCAGTGGTTGCCTGGGGATGG - Intergenic
1071814979 10:89223488-89223510 GACCACAGTCAGCCTGAGGATGG + Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072738830 10:97897225-97897247 AATTATAGGCAGCCTGGGGAAGG + Intronic
1073142577 10:101258590-101258612 CATCACTGGCAGCAGGAGGATGG + Intergenic
1073217840 10:101846344-101846366 CAGGAGAGGCTGCCAGAGGAGGG + Exonic
1074777176 10:116775035-116775057 CAGCAGAGACAGCCACAGGATGG - Intergenic
1075559242 10:123456542-123456564 CATGCCAGGCAGCCTGAGTAAGG + Intergenic
1076042860 10:127266089-127266111 CACCAGTGGCAACCTGTGGATGG + Intronic
1076482818 10:130796045-130796067 CAGCAGAGGCCGCTGGAGGAGGG + Intergenic
1076820213 10:132934810-132934832 CATCAGTGTCATTCTGAGGAAGG - Exonic
1077190174 11:1252692-1252714 CACAAGAGCCTGCCTGAGGAGGG - Intronic
1077537012 11:3129274-3129296 CTTCTGAGGCAGGGTGAGGAGGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078854096 11:15192183-15192205 CAACAGAGGGAGCCAGAGGGAGG - Intronic
1080666055 11:34337310-34337332 CAACACAGACAGCCTTAGGACGG + Intronic
1080694924 11:34595130-34595152 CATCAGGGGCTGTCTCAGGAGGG + Intergenic
1081582986 11:44365208-44365230 CATCAGAACCAGGCTGGGGATGG - Intergenic
1082107781 11:48239433-48239455 GATCAGTAGCTGCCTGAGGAGGG - Intergenic
1082283608 11:50298060-50298082 AATGAGAGGCAGCCTGAGAGGGG + Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083125269 11:60559438-60559460 CAACAGAGGCTGCCTTTGGAGGG - Intergenic
1084712545 11:70852940-70852962 CATCACTGTCAGCCAGAGGAAGG + Intronic
1085314033 11:75532532-75532554 CAGCAGAGGCAGCCAAATGAAGG - Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085519902 11:77131639-77131661 CCTCAGAGGCCCCCTGAGGGAGG - Intronic
1085622207 11:78045989-78046011 AGTTAGAGGCAGCCTCAGGAGGG + Intronic
1085741313 11:79080423-79080445 CAGCAGAGGCTGCCTGAAGGAGG + Intronic
1087211109 11:95447063-95447085 CATCAGAGGGAGGCCGAGGTGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087828546 11:102793913-102793935 CATCACAGCCAGGCAGAGGAAGG - Intronic
1088183664 11:107139968-107139990 CACCAGAGGCAAATTGAGGAGGG - Intergenic
1088371143 11:109089811-109089833 CATCATAGGCAGCTGGAGGGAGG - Intergenic
1088741375 11:112770119-112770141 CATGAGGGTCAGACTGAGGACGG + Intergenic
1089706916 11:120284657-120284679 CAGGAGAGGCAGCCCCAGGATGG - Intronic
1090046516 11:123340051-123340073 GATCAGTGGATGCCTGAGGATGG + Intergenic
1090066652 11:123509706-123509728 CATCAGGGGAACCCTGAGGAAGG - Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1090920006 11:131198912-131198934 TAGCAGAGGCAGCCTGTGGCTGG - Intergenic
1091020245 11:132092961-132092983 GATCAGGGCCAGCCTGAGGTGGG - Intronic
1092090253 12:5798215-5798237 CATGAAAGGCAGCCAGGGGACGG + Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094364262 12:29663402-29663424 CAACAGAGGGAACTTGAGGAAGG - Intronic
1095269847 12:40204811-40204833 CCTCAGAGGTACCCTGTGGACGG + Intronic
1095651027 12:44609380-44609402 CATCCCAGGCAGCATGAGGTTGG + Intronic
1096331235 12:50714834-50714856 CTTCAGAGGCTGACAGAGGATGG + Intronic
1098119750 12:67223371-67223393 CAACAGAGGCACCCTAAGGCAGG + Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098583033 12:72123835-72123857 GATCAGTGGCTGCCTGGGGAAGG - Intronic
1098905697 12:76159978-76160000 CATAAGAGGCTTCCTGAGGGAGG - Intergenic
1103933851 12:124465041-124465063 CTGCAGTGGCAGCCTGAGGCAGG - Intronic
1104941122 12:132395845-132395867 GAGCAGAGGAAGCCTGAGAAGGG + Intergenic
1105220502 13:18322184-18322206 CATCAGAGACTGCCTCAGCATGG - Intergenic
1105546608 13:21355436-21355458 CTTCAGAGCTAGCCTGGGGAGGG + Intergenic
1105864080 13:24443388-24443410 TATCAGAAGAAGCCAGAGGAGGG - Intronic
1107422049 13:40256367-40256389 TATAAGAGGCAGCCTGATTACGG + Intergenic
1108228608 13:48316369-48316391 CTGCAGTGGTAGCCTGAGGAAGG - Intronic
1108830597 13:54473188-54473210 CTTGAGAAGCAGCCTGAGGTTGG + Intergenic
1109120473 13:58449620-58449642 CACCACACGCAGCCTGAGTAGGG + Intergenic
1111795192 13:92910495-92910517 CCTCAGAGGAAGACTGAGGGAGG + Intergenic
1113400911 13:109992568-109992590 CATCTGGAGCAGCCTGAGGAGGG - Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1113834630 13:113320545-113320567 CATGGGAGGCAGCGTTAGGAAGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1117277918 14:54208291-54208313 CTGCAGAGGAAGCCTGCGGAGGG - Intergenic
1119257229 14:73208932-73208954 CATGGGAGGGAGACTGAGGAGGG - Intronic
1121315783 14:92960302-92960324 CATCAGGGGCATCCTGAGAGGGG + Intronic
1121353610 14:93194317-93194339 CATCAGAGGCAGCCTTACTAAGG - Intronic
1121940741 14:98068234-98068256 GATAAGAGGGTGCCTGAGGATGG + Intergenic
1122541471 14:102499952-102499974 CAGCAGAGGCAGCCCCAGGCCGG + Exonic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122836037 14:104431597-104431619 CAGCAGACGCAGCCTGAGGTGGG - Intergenic
1123117421 14:105900965-105900987 GATCAGGGGCGGCCTGAGGGGGG - Intergenic
1123129101 14:105971736-105971758 CCTCAGAGGCATCATGAGGCTGG - Intergenic
1124229424 15:27930680-27930702 GGTCAGAGACTGCCTGAGGATGG + Intronic
1124367190 15:29080465-29080487 CAGCAGAGGCATTGTGAGGAAGG + Intronic
1125479316 15:40069569-40069591 CCTCAGAGGCAGCCTGGGACAGG - Intergenic
1125600862 15:40915235-40915257 CATCAGAGACTTCCTGAGGCGGG + Intergenic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127078102 15:55348098-55348120 CAGCTGAGGCAGGCTGAGGCAGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128178504 15:65579285-65579307 CTTCTGAGGCAGCCTCAGGAAGG + Exonic
1128359653 15:66953102-66953124 GCTCAGAAGCAGCCTGGGGATGG - Intergenic
1129184178 15:73895756-73895778 TGTCAGAAGCATCCTGAGGAAGG + Intergenic
1131080279 15:89528857-89528879 ACTCAGGGGCAGCCTCAGGATGG + Intergenic
1132006285 15:98230380-98230402 CAGCATGGGCAGCATGAGGAGGG + Intergenic
1132806143 16:1776028-1776050 CATGAGAGGGCGCCTGGGGACGG - Intronic
1132861500 16:2073919-2073941 CAACAGAGCCAGCCTGTGAAGGG + Intronic
1134173259 16:11985758-11985780 CAGCAGAGGCTTCCTGAGGCAGG + Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1136683543 16:31981495-31981517 GATGAGGGGCAGCCTGGGGAGGG + Intergenic
1136687520 16:32003914-32003936 CACCAGAGGCAGGCTCAGGAGGG + Intergenic
1136788133 16:32947465-32947487 CACCAGAGGCAGGCTCAGGAGGG + Intergenic
1136881652 16:33906324-33906346 CACCAGAGGCAGGCTCAGGAGGG - Intergenic
1137421369 16:48337599-48337621 CATCACAGGCAACCTGAGCAGGG + Intronic
1137797132 16:51231100-51231122 CATCAGGGGCTGCTTGGGGACGG + Intergenic
1138828560 16:60351369-60351391 CAGCAGTGGCAGGGTGAGGATGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1141894109 16:86947496-86947518 CATAAGTGGCAGGCAGAGGACGG - Intergenic
1142356692 16:89604726-89604748 CAGCTGTGGCTGCCTGAGGAAGG - Intergenic
1203090358 16_KI270728v1_random:1209122-1209144 CACCAGAGGCAGGCTCAGGAGGG + Intergenic
1142786816 17:2230851-2230873 GAACAGAGCCAGCCTGAGCAAGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1142896287 17:2981185-2981207 CATCACAGAAAGCCTGAGAAGGG - Exonic
1143176926 17:4960746-4960768 GATCAAAGGCAGACTCAGGAAGG - Intronic
1143485722 17:7252510-7252532 CATCAGAGGGCGCCAGAGCAGGG + Exonic
1143814031 17:9496760-9496782 CATCAGAGGGAGTATGAAGAAGG + Intronic
1144330666 17:14221215-14221237 GAGCAGAGACAGCCTAAGGAGGG + Intergenic
1144670524 17:17130270-17130292 CTTCTGAGACAGCCTCAGGATGG - Intronic
1144740848 17:17581414-17581436 GAGCAGAGCCAGCCTGAGCAAGG + Intronic
1144852786 17:18252379-18252401 CAGCAGAGGCCTCCTGAGGGAGG - Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1147144457 17:38477202-38477224 GATGAGGGGCAGCCTGGGGAGGG + Intronic
1147148501 17:38499583-38499605 CACCAGAGGCAGGCTCAGGAGGG + Intronic
1147320392 17:39642420-39642442 CAGGAGAGGCAGCCTGGGCAGGG + Intronic
1147773906 17:42887007-42887029 CAGCAGAGGCAGCAGGAAGAGGG + Intergenic
1151202966 17:72482407-72482429 CACCAGCGCCAGCCTCAGGAGGG + Intergenic
1151416628 17:73970519-73970541 CAGCAGAGGCTGCATCAGGAGGG - Intergenic
1151740542 17:75979157-75979179 CCTAGGAGGCAGCCTCAGGACGG + Exonic
1151898150 17:76994273-76994295 CCTCACAGGAAGCCTGAGGTCGG - Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152184626 17:78846760-78846782 CCTGAGAGGAACCCTGAGGAAGG - Intergenic
1152715826 17:81900105-81900127 CATCGGCGCCAGCATGAGGAAGG - Exonic
1152715883 17:81900477-81900499 CCTCAGAGCCAGCCTGAGGGAGG - Intronic
1154357577 18:13633511-13633533 CATCAGTGGGAGGCTGAGGCAGG - Intronic
1155226132 18:23731017-23731039 CATCAAAGGCTGTCTGAAGACGG + Intronic
1157272951 18:46290568-46290590 CCTCAGAGGCAGCCAGCGGGGGG + Intergenic
1158813331 18:61063633-61063655 CACCAGGGGAAGCCTGATGACGG - Intergenic
1161241268 19:3225099-3225121 CGGCAGAGGCAGGCAGAGGAGGG - Intronic
1161885289 19:6989996-6990018 CATCAGATGCAGTTTAAGGATGG - Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162791836 19:13066988-13067010 AATCTGAGACACCCTGAGGAGGG - Intronic
1162812050 19:13170124-13170146 TGTCTGAGGCAGCCTGAGGGTGG - Intergenic
1163279268 19:16305468-16305490 CATCAGAGGAAGCTGGTGGAAGG + Intergenic
1164169173 19:22709313-22709335 CATCAGAGGGACGCTTAGGATGG + Intergenic
1164517646 19:28949709-28949731 CAGCAGAGGGCGCCTGATGAGGG - Intergenic
1164602796 19:29574677-29574699 CATGTGAGGCTCCCTGAGGAGGG + Intergenic
1164753056 19:30670222-30670244 TCTCAGAGGAAGCCTGAGGCTGG - Intronic
1165708919 19:37995784-37995806 CTTCAGATGCAGCCCGAGTATGG + Intronic
1166096267 19:40541376-40541398 CAGCAGAGGGAGCCCGAGGCAGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166861606 19:45814861-45814883 CATCAGAGTAAGGCTGAGGCTGG + Exonic
1167011703 19:46813107-46813129 CATCAGAGGCAGCTGGAGCCGGG + Intergenic
1167588871 19:50391669-50391691 CATCAGAGGGAGACTGAGAGGGG + Intronic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
925249238 2:2417071-2417093 CATCAGTGGCAGGCTAAGGCTGG + Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925694867 2:6566139-6566161 CCTCAGAGGCCATCTGAGGAAGG - Intergenic
926052503 2:9753891-9753913 CAGCAGAGGCAGCCGTGGGAGGG + Intergenic
926128487 2:10286114-10286136 CAGCAGAGGGAAGCTGAGGAGGG + Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928172620 2:29013046-29013068 CAGCTGAGGCTGCCTGAGGCTGG - Intronic
928174547 2:29024775-29024797 CTGCAGAGGCAGCCTGAGCATGG + Intronic
928271199 2:29856653-29856675 CATCGTAGGCAGACAGAGGATGG - Intronic
928335974 2:30398527-30398549 CCTCAGAGGCAGTCTAAGGCAGG + Intergenic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
929957114 2:46466424-46466446 GATTAGAGGCTGGCTGAGGACGG - Intronic
930155779 2:48106510-48106532 CATCTGAGCCAGCCTGGGCAGGG + Intergenic
931274255 2:60730382-60730404 CAACACAGGCAGGCTGAGGTGGG + Intergenic
932274670 2:70443036-70443058 CATCAGAGCCATCCTAAGGATGG - Intergenic
932579853 2:72986035-72986057 GGTCAGATGCAGCCTGAGAAGGG - Intronic
932652407 2:73572708-73572730 CAACAGAGACAGCCTGAGTTGGG + Exonic
934183554 2:89650287-89650309 CATCAGAGACTGCCTCAGCATGG + Intergenic
934293837 2:91724459-91724481 CATCAGAGACTGCCTCAGCATGG + Intergenic
934938809 2:98484503-98484525 GATTCGAGGCAGCCTGTGGAAGG + Intronic
935041117 2:99428130-99428152 CTGCAGAGGCAGCCTTAGCAAGG + Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
936963063 2:118097065-118097087 GATCAGTGGTAGCCTGAGGCTGG - Intronic
938059055 2:128238110-128238132 ACTCAAAGGCAGGCTGAGGAGGG - Intronic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
939376860 2:141379958-141379980 CTTCAGGAGCAGGCTGAGGAAGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941445128 2:165591145-165591167 CATCAGAGTCCTCCTGAGGCTGG - Intronic
941758532 2:169214898-169214920 CATGAGTGACAGGCTGAGGATGG + Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
943812296 2:192202651-192202673 CATCAGAGGTTGCCTAAGCAAGG + Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946412361 2:219521704-219521726 ACTCAGAGGCAGCCTGAGGCCGG - Intronic
947529216 2:230898241-230898263 CATCACTGGCAGCCTGAGGATGG - Intergenic
947995731 2:234525618-234525640 CATCAGAGGCAGCCTCCCCAGGG + Intergenic
948080056 2:235198491-235198513 CAGCAGCCCCAGCCTGAGGAGGG - Intergenic
948197452 2:236106355-236106377 CACCAGAGCCGGCCTAAGGAGGG + Intronic
948338642 2:237231338-237231360 CAGCTGAGACAGCCTGAGCAGGG - Intergenic
948497606 2:238362502-238362524 CCTGTGAGGCACCCTGAGGAAGG - Intronic
948516042 2:238504580-238504602 GATCTGATCCAGCCTGAGGAAGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1170524208 20:17221444-17221466 AAGCAGTGGCAGACTGAGGATGG + Intergenic
1170709727 20:18779349-18779371 CATCTGAAGCAGCCTGTGTAAGG - Intergenic
1170929482 20:20755998-20756020 CATCAGAGGCAGCTTAGGGCTGG - Intergenic
1171192203 20:23166641-23166663 CCTCAGAGGCATCCTGGGCAGGG + Intergenic
1171381590 20:24737921-24737943 CTTCTGAGGCAGCCTCAGCAAGG - Intergenic
1172025689 20:31946696-31946718 CATCAGAGGCCAACTGAGGAAGG + Intronic
1172474321 20:35226297-35226319 CCTGAGAGGCAGCCTGGGGGAGG - Intergenic
1172767988 20:37361302-37361324 CATCCGAGACAGGCTGGGGACGG - Intronic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173705854 20:45110001-45110023 AATCAGAATTAGCCTGAGGAGGG + Exonic
1173865191 20:46308533-46308555 CACCAGAGGCTGCGGGAGGAAGG - Intergenic
1174458788 20:50668329-50668351 CATCAGGGGCAGGAGGAGGAAGG - Intronic
1174565371 20:51461008-51461030 CTTAAGAGGCCACCTGAGGACGG + Intronic
1175769463 20:61614459-61614481 CAACAGACTGAGCCTGAGGAGGG + Intronic
1175933823 20:62506004-62506026 TGTCAGAGTCAGCCTGGGGACGG - Intergenic
1176040033 20:63060504-63060526 CTTCCCAGGCAGCCTGAGGAGGG - Intergenic
1176525359 21:7862491-7862513 CAGCAGAGGCAGCTTGAAGAGGG - Intergenic
1177616249 21:23524740-23524762 CTTCAGTGGCAGCCTGTCGATGG + Intergenic
1177622982 21:23620767-23620789 CATCAGAGTCAGTCAGAGGCAGG + Intergenic
1178027347 21:28483306-28483328 CATCAGAAGGAGACTCAGGATGG + Intergenic
1178659379 21:34492504-34492526 CAGCAGAGGCAGCTTGAAGAGGG - Intergenic
1179598825 21:42461906-42461928 CATCAGAGGCAGGGTGAGGAGGG + Intergenic
1179926319 21:44536217-44536239 CAGGAGCAGCAGCCTGAGGATGG - Intronic
1180665851 22:17511424-17511446 CATCAGGAGCAGCCGGAGGTGGG - Intronic
1181324057 22:22031279-22031301 CATCAGCAGCAGCCAGAGAAGGG + Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181928243 22:26377687-26377709 CATCAGAGGCAGGCGGAGGTTGG - Exonic
1182041103 22:27239566-27239588 CATCAGAGACAACCTGAGCTTGG + Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182571845 22:31245101-31245123 CCCCAGAGGCAGCCAGAAGAAGG - Intronic
1183310338 22:37106331-37106353 CATTAGAGGAAGCCCGAAGAGGG + Intronic
1183353139 22:37344582-37344604 CATCAGAGGCACCAGGATGAGGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184523951 22:45010366-45010388 TATCAGAGGGAGGCGGAGGAGGG - Intergenic
949444161 3:4115433-4115455 TAACACAAGCAGCCTGAGGATGG + Intronic
949864712 3:8537960-8537982 GATCAGAGAAACCCTGAGGAGGG + Intronic
950910980 3:16591539-16591561 CTTCAGAGGGAGGCTGAGGTAGG - Intronic
952252412 3:31667203-31667225 CATCAGAGGCAGTGTGGGCAAGG + Intronic
952306213 3:32148767-32148789 CATCAGAGCCTGCCAGAGCAAGG + Intronic
952312855 3:32205934-32205956 CATATGAGGCATACTGAGGAGGG - Intergenic
953819735 3:46195476-46195498 CATTAAAGGCAGCCAGAGGGGGG + Intronic
953988249 3:47462488-47462510 CATCAGAGGCAGCCACTGAAAGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954711726 3:52508203-52508225 GAGCAGAGGCAGCCTGGGCAGGG + Intronic
955231381 3:57102012-57102034 CATGAGAGGGAGGCTGAGGCAGG + Intronic
957680631 3:83428580-83428602 CAGCTGAGGCAGGCTGAGGCAGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960837661 3:121923905-121923927 AATAAGAGACAGCCAGAGGAAGG - Intronic
963087550 3:141452379-141452401 TATCAAGGGCAGCCTGTGGAGGG + Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964212637 3:154245512-154245534 CATCTGAGGAGGCCTGAAGAGGG - Intronic
964635301 3:158851682-158851704 CATCAGAGGCCAGTTGAGGAGGG - Intergenic
966087966 3:176093158-176093180 AATCAGTGGCTGCCTGAGGGTGG - Intergenic
966329590 3:178795555-178795577 TACCAGAAGAAGCCTGAGGAGGG - Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967200782 3:187070744-187070766 CAACAGAGGTAGTATGAGGATGG - Intronic
967478461 3:189947411-189947433 CATGTGAGGAAGCCTGAGGCAGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969247928 4:5947659-5947681 CCTCAGAGGCAGCAAAAGGAAGG - Intronic
969505615 4:7585401-7585423 CCCCAGAGGCAGCCTCAGGCTGG - Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971372418 4:26029307-26029329 CAGCAGGGCCAGCCTGGGGAGGG - Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
975814730 4:78205886-78205908 CTTGAGAGGAAGCCTGAGGAAGG + Intronic
978045014 4:104114825-104114847 CAGCAGAGGCAGCCTAAGCCTGG + Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979649007 4:123107740-123107762 CATGGGAGGGAGGCTGAGGAGGG - Intronic
979771685 4:124533012-124533034 CATCAGAGCCTGACTCAGGATGG + Intergenic
980354671 4:131725441-131725463 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980355201 4:131727947-131727969 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980355747 4:131730431-131730453 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980356288 4:131732925-131732947 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980356823 4:131735413-131735435 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980357361 4:131737901-131737923 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980357903 4:131740380-131740402 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980358439 4:131742879-131742901 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980358973 4:131745360-131745382 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980359514 4:131747833-131747855 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980360058 4:131750317-131750339 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980360597 4:131752796-131752818 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980361138 4:131755268-131755290 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980361680 4:131757751-131757773 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980362221 4:131760223-131760245 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
980362763 4:131762706-131762728 CTTCAGGGGCAGCCTGGGGGTGG + Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982095763 4:151921822-151921844 CATCAGTGGCATCCTAAGGCTGG - Intergenic
982114585 4:152087160-152087182 TGTCAGGGGCTGCCTGAGGAGGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985306958 4:188554109-188554131 CATCACATACAGCCTGAGGCAGG + Intergenic
985810310 5:2078275-2078297 CATGTGAGGCAGCCTGAGAGAGG + Intergenic
986560004 5:9050912-9050934 CATCAGTGGCCTCCTGAAGAGGG - Intronic
986661360 5:10062956-10062978 ACTCAGAGGCAGACAGAGGAGGG - Intergenic
988525922 5:31987476-31987498 CATCAGAGGCAGCCTGAGGATGG + Intronic
988796849 5:34658986-34659008 CATTAGAGGTTACCTGAGGATGG - Intronic
988808731 5:34764493-34764515 CATTATAGGTAGGCTGAGGAAGG + Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992028936 5:72701321-72701343 CATCAGAGGCAACCTACAGAAGG - Intergenic
992077346 5:73203615-73203637 GATCCGTAGCAGCCTGAGGAAGG - Intergenic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
992997867 5:82350058-82350080 CAAGTGAGGCAGCGTGAGGATGG - Intronic
993158918 5:84263391-84263413 CATCAGTGCCAGCCTGAAGTAGG + Intronic
993342215 5:86738682-86738704 CAGCAGTGGCAGCTTCAGGAAGG + Intergenic
997689201 5:135814226-135814248 AAGCAGAGGCAGCCAAAGGATGG - Intergenic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1001437577 5:171712203-171712225 AATGAGAGGCAGGCTGAGGGTGG - Intergenic
1001504546 5:172266930-172266952 CCCCAGAGGCTGCCTGAGGCAGG + Intronic
1001680258 5:173551784-173551806 CATCAGAGGAAGCATGAGAGAGG + Intergenic
1001744648 5:174082992-174083014 AAGCAGAGGAAGCCTGAGGAAGG - Intronic
1002189382 5:177470814-177470836 CATCAGAGGCACCCCGAGCCTGG + Intronic
1003187861 6:3848964-3848986 CATCAGAGGCGGGAGGAGGAGGG + Intergenic
1003298431 6:4854710-4854732 CATCAGTGGCAGCACAAGGAAGG + Intronic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1003342337 6:5233764-5233786 TATCAGATGCAGGCTGAGCATGG - Intronic
1003405085 6:5821325-5821347 CTTCAGATCCAGCCTGGGGATGG - Intergenic
1004410176 6:15374201-15374223 CAGAAGAGGCAGCATGCGGAAGG + Exonic
1004425252 6:15502676-15502698 CATGAGATGCAGCCTGAGGCGGG - Intronic
1004626158 6:17379286-17379308 CATCAGTGGGTGCCTGGGGATGG + Intergenic
1006368921 6:33632684-33632706 CAGCAGAGGGAGCAGGAGGATGG - Intronic
1006860564 6:37169677-37169699 CATCAAAGGCCGCCCGAGGCCGG - Intergenic
1007611251 6:43150730-43150752 CACCTGAGGCATTCTGAGGACGG + Intronic
1007936531 6:45737469-45737491 GAGCAGAGCCAGTCTGAGGAGGG - Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008787702 6:55189401-55189423 CATGAGAGGCAGTCTGAAGATGG + Intronic
1010505068 6:76646998-76647020 TACCAGAAGCAGCCTGAGGGAGG - Intergenic
1012366719 6:98449756-98449778 CATCAGTGGATGCCTGAGGCTGG - Intergenic
1012704038 6:102498706-102498728 CCTCAGAGTCAGGCTCAGGAAGG - Intergenic
1012946812 6:105475060-105475082 CATCAGTGGAAGCCAGATGATGG - Intergenic
1013751705 6:113414693-113414715 CAACAGAGGGAGCCTGGAGATGG + Intergenic
1013938510 6:115630817-115630839 CAGCAGAGGAAGCCTGTGTATGG + Intergenic
1014495245 6:122113655-122113677 TATCAGAGGCTGCCTGGGGCAGG - Intergenic
1014806650 6:125837730-125837752 CTTAGGAGGCAGCATGAGGAAGG + Intronic
1016117594 6:140306769-140306791 GATCAGAGATTGCCTGAGGATGG + Intergenic
1016738989 6:147508748-147508770 CATCAGAAGAAGCCTGAGGAAGG - Intergenic
1017369182 6:153684465-153684487 CATCAGAGCCAATCTGAGGTGGG + Intergenic
1018578901 6:165290433-165290455 CATCAGACACAGCAGGAGGAAGG + Intronic
1018931228 6:168241691-168241713 CCTCAAAGGCGGCCAGAGGAGGG + Intergenic
1019191366 6:170252960-170252982 CTTTGGAGACAGCCTGAGGAAGG - Intergenic
1019352917 7:563329-563351 CTGCAGAGGCAGCCTGTGGAGGG - Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019940216 7:4283597-4283619 CAGCAGTGGCAGCCGCAGGAAGG - Intergenic
1020017114 7:4837497-4837519 TATCAGAGACAGCCTTGGGAAGG - Intronic
1020044686 7:5032091-5032113 CAGCAGAGCCCTCCTGAGGAAGG - Intronic
1020290040 7:6716113-6716135 CAGCAGAGCCCTCCTGAGGAAGG - Intergenic
1020391730 7:7665702-7665724 TATCAGAGGTTGCCTGGGGAGGG - Intronic
1020440264 7:8209986-8210008 GGTCAGAGCCAGCCTGTGGAGGG + Intronic
1020939909 7:14519264-14519286 TATCAGAGGTTGCCTGAGGCTGG - Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022652410 7:32289296-32289318 ACTCAGAGGCAGGCTGAGGCAGG + Intronic
1023124935 7:36946050-36946072 CAGCAGAGGTAGCCTGAGCTGGG + Intronic
1023825643 7:44007113-44007135 CAGCAGAGCCCTCCTGAGGAAGG + Intronic
1024263174 7:47587048-47587070 CAGGAGAGGGAGCCTGGGGAGGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026089195 7:67285889-67285911 CAGCAGAGCCCTCCTGAGGAAGG + Intergenic
1026725056 7:72864461-72864483 CAGCAGAGCCCTCCTGAGGAAGG - Intergenic
1026747188 7:73022657-73022679 CAGCAGAGCCCTCCTGAGGAAGG - Intergenic
1026750838 7:73050800-73050822 CAGCAGAGCCCTCCTGAGGAAGG - Intergenic
1026754487 7:73078910-73078932 CAGCAGAGCCCTCCTGAGGAAGG - Intergenic
1026758139 7:73106943-73106965 CAGCAGAGCCCTCCTGAGGAAGG - Intergenic
1027033292 7:74907228-74907250 CAGCAGAGCCCTCCTGAGGAAGG - Intergenic
1027089266 7:75286541-75286563 CAGCAGAGCCCTCCTGAGGAAGG + Intergenic
1027092909 7:75314469-75314491 CAGCAGAGCCCTCCTGAGGAAGG + Intergenic
1027096552 7:75342436-75342458 CAGCAGAGCCCTCCTGAGGAAGG + Intergenic
1027118785 7:75501207-75501229 CAGCAGAGCCCTCCTGAGGAAGG + Intergenic
1027273011 7:76534252-76534274 CAGCAGAGCCCTCCTGAGGAAGG - Intergenic
1027322795 7:77025244-77025266 CAGCAGAGCCCTCCTGAGGAAGG - Intergenic
1027326460 7:77053336-77053358 CAGCAGAGCCCTCCTGAGGAAGG - Intergenic
1027459055 7:78429370-78429392 GGTCAGAGGTAGGCTGAGGAGGG + Intronic
1029397661 7:100319410-100319432 CAGCAGAGCCCTCCTGAGGAAGG + Intronic
1029504106 7:100951683-100951705 CATCAGAGGCAGCTTGGAGCTGG - Intronic
1029718702 7:102348810-102348832 CAGCAGAGCCCTCCTGAGGAAGG - Intergenic
1029753913 7:102560445-102560467 CAGCAGAGCCCTCCTGAGGAAGG + Intronic
1029771863 7:102659535-102659557 CAGCAGAGCCCTCCTGAGGAAGG + Intronic
1032784627 7:135191127-135191149 CAGCAAAGGCAGCCAGAGGATGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034460627 7:151196111-151196133 CGTCAGAGGGTTCCTGAGGATGG + Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1034970857 7:155418285-155418307 CAGCTGAGGCAGCCTGAAGGAGG + Intergenic
1035635029 8:1138120-1138142 CAGCAGAGCGAGCCTGAGAATGG + Intergenic
1036447814 8:8838228-8838250 CATCAGTGGTTGCCTGAGGCTGG + Intronic
1036785744 8:11685466-11685488 CATCGTAGGAAGCCTGAAGAAGG - Intronic
1037597465 8:20366492-20366514 CATCAGTGGTTGCCTGGGGATGG - Intergenic
1037952424 8:23027898-23027920 ACTCAGAGACACCCTGAGGAAGG + Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039861953 8:41466726-41466748 CCTCAGGGCCAGGCTGAGGAGGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1044506045 8:93020733-93020755 AATCAGATGCTGACTGAGGAGGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045519651 8:102892696-102892718 CCTCAGAGGCAGCTTGCAGAAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046890268 8:119415099-119415121 AATCAAAGGCAGCTTGCGGAAGG - Intergenic
1047272321 8:123373865-123373887 TAACAGATGCAGCCTAAGGATGG - Intronic
1047757806 8:127932018-127932040 CAACAGAGGAAGCCTGAGGATGG - Intergenic
1047885077 8:129241244-129241266 CATCAGAGGCACATTGTGGATGG + Intergenic
1047928663 8:129704739-129704761 GATCTGAGGCAGCCTGACAAAGG - Intergenic
1047985926 8:130233608-130233630 GATCTGAGGTAGCGTGAGGAAGG - Intronic
1049470955 8:142774792-142774814 CACCAGGGGCAGACTGAGGCAGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051410283 9:16782583-16782605 CTTCAGAGTCAGCCAGTGGAAGG - Intronic
1055197537 9:73614735-73614757 CATCAGTGGCCACCTTAGGAGGG - Intergenic
1056580485 9:87885738-87885760 CATCAGAGACTTGCTGAGGACGG - Exonic
1056871688 9:90287755-90287777 CTTCAGGGCCAGCCTGAGGCAGG + Intergenic
1057825765 9:98371099-98371121 CATCCGTGGCAGCCTGGGGATGG - Intronic
1057906490 9:98987408-98987430 CAGCAGCCGCAGCCTGGGGAGGG + Intronic
1057992608 9:99786380-99786402 GCTCAGAGGCTGCCAGAGGAGGG - Intergenic
1058650595 9:107172285-107172307 CATCAGAGGTGGACTTAGGATGG - Intergenic
1058726717 9:107811737-107811759 CATCACAGGTTGCCTAAGGAGGG - Intergenic
1060917960 9:127402605-127402627 CATGAGAAGCAGCATGAGGGAGG - Exonic
1061260394 9:129477379-129477401 TCTCAGAGGCAGGCTCAGGAAGG - Intergenic
1062232317 9:135488533-135488555 CTGCAGTGGTAGCCTGAGGAAGG + Exonic
1062631098 9:137463519-137463541 CACCACAGGGAGCCTGGGGAGGG + Exonic
1185480223 X:440743-440765 CAGCAGCAGCAGCCTGAGGAAGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188461782 X:30435516-30435538 CATAAGAGGGAGCAGGAGGAGGG - Intergenic
1188487847 X:30702962-30702984 CATCTGAGTCAGCCTGAGTCTGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190222330 X:48520511-48520533 CATCAGTGGCACCCTGAGAGGGG - Exonic
1192846025 X:74907918-74907940 CAGCTGAGACAGCCTGAGGTGGG - Intronic
1195491031 X:105470088-105470110 CTTCACAGGCACCCTGAGAATGG + Intronic
1197386124 X:125804561-125804583 CACCAGGGGCTACCTGAGGATGG + Intergenic
1197570156 X:128140629-128140651 TATCAGAGGTTGCCTGAGTAAGG - Intergenic
1197851463 X:130865341-130865363 CATATGAGGCAGCCAGAGGGAGG - Intronic
1198934878 X:141895242-141895264 CAGCAGAGGCAGCGTGGGGTGGG - Intronic
1199843410 X:151673448-151673470 CATCAGAATCCACCTGAGGAGGG + Intronic
1201374753 Y:13306810-13306832 CATCGGAGGGAGACTGAGGCAGG - Intronic