ID: 988530744

View in Genome Browser
Species Human (GRCh38)
Location 5:32025128-32025150
Sequence TTTTTCCTTCCTTTCTTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5268
Summary {0: 1, 1: 1, 2: 47, 3: 527, 4: 4692}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988530744_988530747 1 Left 988530744 5:32025128-32025150 CCTAGAAAGAAAGGAAGGAAAAA 0: 1
1: 1
2: 47
3: 527
4: 4692
Right 988530747 5:32025152-32025174 AAGGAAGGAAAGAAGCAGCAAGG 0: 1
1: 4
2: 66
3: 868
4: 4242
988530744_988530752 30 Left 988530744 5:32025128-32025150 CCTAGAAAGAAAGGAAGGAAAAA 0: 1
1: 1
2: 47
3: 527
4: 4692
Right 988530752 5:32025181-32025203 TATTGATCTGGGGAAGGCAGCGG 0: 1
1: 0
2: 1
3: 25
4: 226
988530744_988530749 19 Left 988530744 5:32025128-32025150 CCTAGAAAGAAAGGAAGGAAAAA 0: 1
1: 1
2: 47
3: 527
4: 4692
Right 988530749 5:32025170-32025192 CAAGGAGCTCATATTGATCTGGG No data
988530744_988530750 20 Left 988530744 5:32025128-32025150 CCTAGAAAGAAAGGAAGGAAAAA 0: 1
1: 1
2: 47
3: 527
4: 4692
Right 988530750 5:32025171-32025193 AAGGAGCTCATATTGATCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 136
988530744_988530751 24 Left 988530744 5:32025128-32025150 CCTAGAAAGAAAGGAAGGAAAAA 0: 1
1: 1
2: 47
3: 527
4: 4692
Right 988530751 5:32025175-32025197 AGCTCATATTGATCTGGGGAAGG 0: 1
1: 0
2: 2
3: 5
4: 98
988530744_988530748 18 Left 988530744 5:32025128-32025150 CCTAGAAAGAAAGGAAGGAAAAA 0: 1
1: 1
2: 47
3: 527
4: 4692
Right 988530748 5:32025169-32025191 GCAAGGAGCTCATATTGATCTGG 0: 1
1: 0
2: 0
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988530744 Original CRISPR TTTTTCCTTCCTTTCTTTCT AGG (reversed) Intronic
Too many off-targets to display for this crispr