ID: 988530749

View in Genome Browser
Species Human (GRCh38)
Location 5:32025170-32025192
Sequence CAAGGAGCTCATATTGATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988530744_988530749 19 Left 988530744 5:32025128-32025150 CCTAGAAAGAAAGGAAGGAAAAA 0: 1
1: 1
2: 47
3: 527
4: 4692
Right 988530749 5:32025170-32025192 CAAGGAGCTCATATTGATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988530749 Original CRISPR CAAGGAGCTCATATTGATCT GGG Intronic
No off target data available for this crispr