ID: 988532202

View in Genome Browser
Species Human (GRCh38)
Location 5:32037670-32037692
Sequence TTCAATAAGCAGGAGAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 572
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 525}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988532200_988532202 10 Left 988532200 5:32037637-32037659 CCTTTCAATGTGGAGTTAATATC 0: 1
1: 0
2: 0
3: 8
4: 130
Right 988532202 5:32037670-32037692 TTCAATAAGCAGGAGAAAGATGG 0: 1
1: 0
2: 2
3: 44
4: 525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988532202 Original CRISPR TTCAATAAGCAGGAGAAAGA TGG Intronic
900323144 1:2094886-2094908 TTTTATAGGCAGGAGAGAGAGGG - Intronic
902563702 1:17295799-17295821 TTCAAGAAGCAGAAGACAGCTGG - Intergenic
903329888 1:22591940-22591962 TCCAATAAACAGGAGAATGGGGG - Intronic
903354430 1:22737524-22737546 TTCACTAGGCAGAAGCAAGAAGG - Intronic
904426337 1:30425742-30425764 CTCACTCTGCAGGAGAAAGAAGG + Intergenic
904680939 1:32228713-32228735 GTCAAAAAGCTGGAGAGAGAAGG - Exonic
904829342 1:33296623-33296645 TTGGATGAGGAGGAGAAAGAGGG + Intronic
906011233 1:42528517-42528539 TTAAATGAGAGGGAGAAAGAAGG + Intronic
906182723 1:43835746-43835768 TTTCATAAACAGCAGAAAGATGG - Intronic
907806037 1:57821279-57821301 CTCAATAAGGAAGAGATAGAGGG + Intronic
909572252 1:77128242-77128264 TTAAAGAAGCACAAGAAAGATGG + Intronic
910376118 1:86573160-86573182 TAAATTAAGCAGGAGAAAGACGG + Intronic
910682861 1:89885103-89885125 TTTAATAGGCAGCAGACAGATGG - Intronic
911364697 1:96923028-96923050 TTCCAGAAGCAGGAAAAAGAGGG + Intergenic
911575854 1:99577142-99577164 CTCAATAAGAAGGAAAAAAATGG + Intergenic
911763813 1:101648663-101648685 TTCAATAAGCAGAATATATAAGG - Intergenic
911839645 1:102664370-102664392 TTCAATAAATAGGAAAATGATGG - Intergenic
912173186 1:107125618-107125640 TTCAAAAGGAAGGAGAAAAAAGG + Intergenic
913429291 1:118772395-118772417 TTCCATAAGATAGAGAAAGAGGG + Intergenic
914738844 1:150446300-150446322 TTAGATAAGCAGGTGAAAAACGG + Exonic
914886999 1:151593764-151593786 TTCAAAAAGCGGCAGAGAGATGG + Intergenic
917168795 1:172145430-172145452 TTCAACAGACAGGAGAAGGAGGG - Intronic
917286080 1:173422845-173422867 TTCAACCAACAGGAGTAAGACGG + Intergenic
917492523 1:175509834-175509856 TTCAATCCTCAGGAAAAAGAAGG - Intronic
917575942 1:176321931-176321953 TTAAATTAACAGGAGACAGAAGG - Intergenic
917907695 1:179603912-179603934 TTCCACAAGCTAGAGAAAGAGGG - Intronic
918049026 1:180958411-180958433 TTCAGTGAGCAGGGGAATGAAGG + Intergenic
918702177 1:187618797-187618819 TTCAGTCAGCAGGTGAAAAAGGG - Intergenic
919214212 1:194531401-194531423 TTCCAGAAGAAAGAGAAAGATGG - Intergenic
919319746 1:196020899-196020921 TTTAATAGGCAAGAGAAAGAAGG + Intergenic
919869264 1:201808289-201808311 TTCAATCAGCATGAGAAGAAAGG - Intronic
920423748 1:205856398-205856420 TTCCATAAGATAGAGAAAGAGGG + Intergenic
921421546 1:214954590-214954612 TTCTATAACAAGGACAAAGAAGG - Intergenic
921572040 1:216791304-216791326 TGGAGCAAGCAGGAGAAAGAGGG - Intronic
921935467 1:220791820-220791842 ATCTAAAAGAAGGAGAAAGAAGG + Intronic
922041454 1:221902489-221902511 GTCAATAACCAGGAGGGAGAAGG - Intergenic
922310283 1:224382230-224382252 AACAAAAAGCAGGAGCAAGAAGG - Intergenic
923106985 1:230861979-230862001 TTCTATAAGCTAGAGAAATAAGG + Intronic
923648534 1:235848972-235848994 TTCCACAAGAAAGAGAAAGAGGG + Intronic
924468970 1:244322926-244322948 TTTAAAAAGCAGTAGCAAGACGG + Intergenic
924671684 1:246133711-246133733 TATAAGAAGAAGGAGAAAGAGGG + Intronic
1062882128 10:987865-987887 TTTAACAAGCACGAGAAAGCAGG + Intergenic
1063057057 10:2517069-2517091 TACAAGAAGCAGGATAAGGAAGG - Intergenic
1063090048 10:2856973-2856995 TTTAATAAGAAAGAGAGAGAAGG + Intergenic
1063528126 10:6803321-6803343 TTAAATAAGCAGGAGGGAGTAGG - Intergenic
1063538129 10:6905386-6905408 TGGAATATGCAGGAGGAAGAAGG - Intergenic
1063563856 10:7154431-7154453 TTCAATAAACAAGAGAGAGAAGG + Intergenic
1063898947 10:10712021-10712043 TTCTATAAACAGGAAAATGATGG - Intergenic
1064934282 10:20662654-20662676 CTCAAAAAGCAGGTAAAAGAAGG - Intergenic
1065400207 10:25291112-25291134 TTCAACAAGATGGGGAAAGATGG - Intronic
1065444337 10:25781970-25781992 GAAAAGAAGCAGGAGAAAGAAGG + Intergenic
1065456722 10:25914151-25914173 CCCAATGAGAAGGAGAAAGATGG + Intergenic
1067938219 10:50629543-50629565 ATCAACATGCAGGAGAGAGATGG - Intergenic
1068777461 10:60883551-60883573 TTCAGTGAGCTGGACAAAGAAGG + Intronic
1068983556 10:63086525-63086547 CACAAAAAGCAAGAGAAAGAAGG - Intergenic
1069098234 10:64286572-64286594 TTGATGAAGCAGGAGAAAGAGGG - Intergenic
1069244650 10:66188706-66188728 TGCAATAAGCAGGAGAGTGTAGG + Intronic
1069883768 10:71610672-71610694 TTTAATAAATAGGAGAATGAAGG + Intronic
1070366529 10:75742366-75742388 TTCAACAAGATGGAGAGAGAGGG + Intronic
1070533303 10:77356527-77356549 TTCAACATCCAGGAGCAAGATGG + Intronic
1071851738 10:89579454-89579476 TTAAATGAGCAGGGGAAAAAAGG + Intergenic
1073405766 10:103296318-103296340 ATCAATAACCAGGAAAGAGATGG - Intergenic
1073623525 10:105073361-105073383 TTCTCTAAGCAGGAGAAACAAGG - Intronic
1073862450 10:107763120-107763142 TTCCAAAAGAAGAAGAAAGAAGG - Intergenic
1074006560 10:109431120-109431142 TTGAATAAGCAGGAAGAACAGGG - Intergenic
1074878584 10:117633712-117633734 TTCCAGAGGAAGGAGAAAGATGG - Intergenic
1075315890 10:121453284-121453306 GTCGAAAAGCAGCAGAAAGATGG - Intergenic
1075742377 10:124703739-124703761 AACAAAAAGCAGCAGAAAGAAGG + Intronic
1075829438 10:125393392-125393414 TGCATTAAGCAGGAGAACGAAGG + Intergenic
1075899932 10:126033386-126033408 TGCACTTAGCAGGAGAAATAGGG - Intronic
1075989356 10:126821626-126821648 TACTTTAAGCATGAGAAAGATGG + Intergenic
1076020408 10:127067772-127067794 TAAACTAAGCAGGAGACAGAGGG - Intronic
1076092197 10:127696701-127696723 TCCAATAAACAGGGGAAAGAAGG - Intergenic
1078248814 11:9600481-9600503 TTCAGGTACCAGGAGAAAGAAGG - Intergenic
1078997415 11:16717676-16717698 TGCAAAAAGTAAGAGAAAGAGGG - Intronic
1079448136 11:20574934-20574956 TGCAAAAAGCAAGAAAAAGAAGG + Intergenic
1079451857 11:20604917-20604939 TTCAAGAAGCAGAAGAAGGCGGG - Intronic
1080522659 11:33081103-33081125 TTTTATAAACAGGAAAAAGATGG + Intronic
1080585589 11:33679390-33679412 TTCCATAAGATAGAGAAAGAGGG - Intergenic
1081596277 11:44461809-44461831 GTCAATAAGGAGGGGAATGAGGG + Intergenic
1083877047 11:65529737-65529759 TTCACAAAGGAGGAGACAGAGGG - Intronic
1084600407 11:70142232-70142254 TGCAAAAAGCCGGAGAAAGATGG + Intronic
1085138573 11:74118524-74118546 TTGTATAACCAGGAGAAATATGG - Intronic
1086269768 11:85048235-85048257 GACAATTAACAGGAGAAAGATGG - Intronic
1086547907 11:88019657-88019679 TTCAAAGAGTAGGAGAAACAGGG - Intergenic
1086686493 11:89739564-89739586 TTCAAATTGCAGGAGAAGGATGG - Intergenic
1086783731 11:90938823-90938845 CTCAAAAAGCAGGAGAGTGAAGG + Intergenic
1086877635 11:92115978-92116000 TTCCAAAAGATGGAGAAAGAAGG + Intergenic
1087890027 11:103527417-103527439 TTCAATAAGCAGAAAATAGAAGG - Intergenic
1088379031 11:109173089-109173111 TTCAGAAACCAGGAGATAGAAGG - Intergenic
1088494366 11:110418694-110418716 TTGAACATGCAGGAGAAGGAGGG - Intergenic
1089437670 11:118484198-118484220 GTCAATAAGCAGGAGAATGCAGG + Exonic
1089689887 11:120180697-120180719 CTCAATTAACAGGAGAAAGCTGG - Intronic
1089952603 11:122543500-122543522 TTCCACAAGATGGAGAAAGAGGG - Intergenic
1090486729 11:127119290-127119312 TTCAATAACCAGGAGATTGAAGG - Intergenic
1090849110 11:130555919-130555941 TTCAATCAACATGACAAAGAGGG + Intergenic
1091039861 11:132267012-132267034 TTCAAATAGCAGAGGAAAGACGG + Intronic
1091091010 11:132771315-132771337 TTCAATAAACAGGGCCAAGAAGG + Intronic
1091150161 11:133320978-133321000 TTCAATAAACAGGAGACAGCTGG + Intronic
1091329276 11:134718049-134718071 TTCAAAAAGCAGGAGAAGGCAGG + Intergenic
1091331497 11:134734861-134734883 TAGAATAAACAGGAGAGAGAGGG - Intergenic
1091407082 12:215710-215732 CTCCATAAAAAGGAGAAAGAGGG + Intergenic
1092388891 12:8057779-8057801 TTCAAGTGGAAGGAGAAAGAGGG - Intergenic
1093390979 12:18620798-18620820 TTAAATAACCAGGATTAAGAGGG - Intronic
1093743610 12:22715142-22715164 GGCAGTAAGAAGGAGAAAGAGGG - Intergenic
1093932115 12:24964587-24964609 TTAAAAATGCAGGAGAAAAAAGG - Intergenic
1094748368 12:33374430-33374452 TTCAATTACAAGCAGAAAGATGG + Exonic
1094810099 12:34128172-34128194 TTCTATAAGATAGAGAAAGAAGG + Intergenic
1095461610 12:42450108-42450130 TTCATTAAGTAGGAGAGAAAGGG - Intronic
1096987100 12:55767164-55767186 TTCAAGGACCAGGAGAAATACGG - Intronic
1097208543 12:57345857-57345879 ATCAAAAACCAGGAGAATGAGGG + Intronic
1097759523 12:63446255-63446277 TTCAAAAAGCAGGAGAAAATGGG + Intergenic
1097982299 12:65746844-65746866 TTGAATGAAGAGGAGAAAGAAGG + Intergenic
1099108696 12:78528918-78528940 TGAGATAAGCAGGAGAAAGAAGG - Intergenic
1100033214 12:90218721-90218743 TCCGATAATCAGGAGAAAGTAGG - Intergenic
1100648424 12:96557318-96557340 GACAATAAGCAAAAGAAAGAAGG + Intronic
1100660217 12:96689113-96689135 TTCAGCCAGCAAGAGAAAGACGG - Intronic
1100676600 12:96875486-96875508 TTCAAAACGCAGGAGAGAGTGGG - Exonic
1100899125 12:99218170-99218192 TTCAAAAAGCAGAAGTTAGAAGG - Intronic
1100935634 12:99661899-99661921 TTCAATCAGCAGGAAGAGGAAGG - Intronic
1101484371 12:105137443-105137465 TTGAAAAATAAGGAGAAAGAGGG - Intronic
1101960834 12:109248632-109248654 TAGAAAAAGCAGGTGAAAGAAGG - Intronic
1102614541 12:114141979-114142001 TCCAAGAAGCATGAGAATGAAGG - Intergenic
1102891679 12:116563798-116563820 TTAAAGAACCAGGAGAAACAAGG - Intergenic
1103206890 12:119136816-119136838 TTCCTTAAGCAGGAGCCAGAGGG - Intronic
1103263331 12:119608462-119608484 TTCAATGAGAAGGAAAATGAAGG + Intronic
1103459082 12:121089589-121089611 TTCCAGAAGCAGGTGGAAGATGG + Intergenic
1104074955 12:125380781-125380803 CTCATTAAGCAGGAGAAATGTGG - Intronic
1105906476 13:24815741-24815763 CTCAATAAACAAGAGACAGAAGG - Intronic
1108224790 13:48277453-48277475 GTCAGTAAGGAAGAGAAAGAAGG - Intergenic
1108297319 13:49037473-49037495 TTGGATAAGGAGGAGATAGAAGG + Intronic
1109000605 13:56798294-56798316 ATCAATAAGTAGTATAAAGAGGG - Intergenic
1109368523 13:61390573-61390595 TTAAATAACCAGGAAAGAGATGG - Intergenic
1109987327 13:70006116-70006138 TGAAATAAGCAAGACAAAGAGGG - Intronic
1110419804 13:75293631-75293653 TTCAATAAACAAGAGAAATCTGG + Intronic
1110522716 13:76499551-76499573 ATTAATAAGCTGGATAAAGAAGG + Intergenic
1110720635 13:78757608-78757630 TTCAAAAAGCAAGGGAAATAAGG + Intergenic
1111707275 13:91765853-91765875 TTCAGTGAGTGGGAGAAAGAGGG + Intronic
1111961901 13:94820863-94820885 TTCAATAAAAAAGAGAAGGAAGG - Intergenic
1111988716 13:95093148-95093170 TTCCATAAGACAGAGAAAGAAGG + Intronic
1112061500 13:95743853-95743875 TTAAATAAGCAGGAGGCAGCCGG - Intronic
1112125851 13:96467275-96467297 TATGATAAGAAGGAGAAAGAAGG + Intronic
1112606813 13:100914454-100914476 TGTAAAAGGCAGGAGAAAGAGGG - Intergenic
1113757708 13:112825183-112825205 TGCCACAAGCAGGAGAGAGAGGG - Intronic
1114676173 14:24441790-24441812 TTCCATCTGCAGGAGAAACATGG + Exonic
1114981590 14:28171579-28171601 TTCAGTCAACAGAAGAAAGAGGG + Intergenic
1116416617 14:44685256-44685278 TTCAATAGGCAGAGCAAAGAGGG - Intergenic
1116643455 14:47496183-47496205 TTCCACAAGCAGGTGGAAGAAGG + Intronic
1116668775 14:47814193-47814215 TTCCATAAGATAGAGAAAGAGGG - Intergenic
1116755642 14:48944405-48944427 TTCAATAAAAAGGGGAAAGTTGG + Intergenic
1116859271 14:49980671-49980693 ATCAATAAGCTGGGGAAGGAGGG + Intergenic
1116862455 14:50005525-50005547 TTAAATAAGCAGCAGGAAGAAGG + Intronic
1117905894 14:60585748-60585770 TTCAAGAAGAAGTAAAAAGATGG - Intergenic
1118826127 14:69383493-69383515 TTGAATATTCAGGAGAAATAAGG - Intronic
1119067239 14:71541420-71541442 TTCAAAGAGCAGGAAACAGATGG + Intronic
1119717828 14:76871232-76871254 TTTAATAAGGAAGAGAAAGGGGG - Intergenic
1120032597 14:79659579-79659601 TACACTAATGAGGAGAAAGAAGG + Intronic
1120969682 14:90197024-90197046 TAGAATTAGGAGGAGAAAGAGGG - Intergenic
1121283602 14:92717298-92717320 TTCTAGAAACAGAAGAAAGAGGG + Intronic
1121503179 14:94455555-94455577 TTCAACAAGATAGAGAAAGAGGG - Intergenic
1122322653 14:100864711-100864733 TCCATTAAGCTGGAGAGAGATGG + Intergenic
1122414881 14:101544605-101544627 TTCCCAAAGCAGGAGAAAGCAGG + Intergenic
1122493167 14:102133802-102133824 TACACTATGAAGGAGAAAGAGGG + Intronic
1122679342 14:103445740-103445762 GCCAAAAAGCAGGAAAAAGATGG - Intronic
1124180807 15:27471746-27471768 TTAAATTAGTAGGAGGAAGAAGG - Intronic
1125732563 15:41901445-41901467 TTAAAAAGGCAGGTGAAAGAAGG - Intronic
1126444667 15:48728781-48728803 TTCCAGAAGCAGGAAACAGAAGG + Intronic
1126977572 15:54201270-54201292 TTCCAAAAGATGGAGAAAGAGGG + Intronic
1127001425 15:54512336-54512358 TTCCATGAGCAGAAGAAGGAAGG + Intronic
1127226701 15:56938542-56938564 TTCCATAAGACAGAGAAAGAGGG - Intronic
1127597718 15:60503473-60503495 TTTAATAAGCGGGTGAAAGCAGG + Intronic
1127678466 15:61269118-61269140 TTCAGTAATGAGGGGAAAGAGGG + Intergenic
1128406524 15:67346044-67346066 ATTAATAAAAAGGAGAAAGATGG + Intronic
1128601402 15:68998297-68998319 TTCAGTAGGAGGGAGAAAGAAGG + Intronic
1128805030 15:70524415-70524437 TTCAATGAGCAGGAGCCAGATGG + Intergenic
1129074298 15:72978457-72978479 TTGAATAAGCTGGAGGAAGCAGG - Intergenic
1129166172 15:73779356-73779378 TTCAATAAGGAGGAGAGTCAAGG - Intergenic
1129416889 15:75388679-75388701 GTCTATAAGAAGGAGAAAGCTGG + Intronic
1129553786 15:76483046-76483068 TTAAATAAGAAGGATAAAGTTGG + Intronic
1129816967 15:78563916-78563938 ATCAATAATCATGAGAATGATGG - Intergenic
1130605189 15:85309438-85309460 TTCCAAAAGAATGAGAAAGAGGG + Intergenic
1130943718 15:88534427-88534449 TTCAAGCAGCAGGAGAACCAGGG - Intronic
1131174075 15:90199268-90199290 TGCAGTAACCAGGAGAAAGAGGG + Intronic
1131870747 15:96761618-96761640 TTTCATCAGCAGGAGAGAGAAGG - Intergenic
1132421176 15:101671134-101671156 TTGAAAAAGCAGGGGAAAAAAGG - Intronic
1132457695 16:33266-33288 GCCAGTCAGCAGGAGAAAGATGG + Intergenic
1133453824 16:5925098-5925120 ATCAATAATCAGGAGAGACAAGG - Intergenic
1134023582 16:10938539-10938561 TTCCATAAGCAGGGGAACGCCGG - Intronic
1134203622 16:12219616-12219638 TTCAATAAGGAAGAGAGAAAGGG - Intronic
1134853475 16:17500648-17500670 TTCCCTAAGAAGGAAAAAGAAGG - Intergenic
1135644248 16:24147380-24147402 CCCAATAAGCAGGACAAACACGG - Intronic
1135933436 16:26759112-26759134 TTCAATAAGGAGAAAAAAAAAGG - Intergenic
1137054373 16:35736257-35736279 TGCAACAAGCGGGAGAAAGCGGG - Intergenic
1137055761 16:35746117-35746139 TGCGATAAGCGGGAGAAAGCGGG - Intergenic
1137056871 16:35750188-35750210 TTCAACAAGCGGGGGAAAGCAGG - Intergenic
1137340572 16:47599313-47599335 GGCAAAAAGCAGGATAAAGAAGG - Intronic
1137805557 16:51301882-51301904 CTGAAGAAGCAGCAGAAAGAAGG - Intergenic
1138401887 16:56752703-56752725 TTTAAAAAGCAGAAGAAAGTTGG + Intronic
1139622156 16:68154243-68154265 TTCAGTACCCAGGAGAATGATGG - Intronic
1140085708 16:71794370-71794392 TTAAAAAAACAGGACAAAGAGGG - Intronic
1140165047 16:72542463-72542485 TTAAATAGGCAGAAGAAAGGAGG - Intergenic
1140379890 16:74477128-74477150 TTTAATAAGCAACAGGAAGAGGG + Intronic
1140397122 16:74637037-74637059 TTCAACAAGCAAGTGAAATAAGG + Intronic
1140858767 16:79001065-79001087 ATTAATCTGCAGGAGAAAGAAGG + Intronic
1141525909 16:84611652-84611674 ATGAATAAACAGGAGAATGAAGG + Intronic
1142077068 16:88125382-88125404 TTCCAAAAGACGGAGAAAGAGGG + Intergenic
1144031698 17:11328859-11328881 TTCAATAAGGAGCTGAATGAAGG + Intronic
1144139373 17:12333362-12333384 TTCCACAAGCTAGAGAAAGAAGG - Intergenic
1144324472 17:14165532-14165554 TCCAAGGAGCAGGAGAGAGATGG - Intronic
1148511904 17:48178098-48178120 TTTAGGAGGCAGGAGAAAGATGG + Intronic
1149171591 17:53818651-53818673 TTTAATAAGCAGGGGAAAGATGG + Intergenic
1149300242 17:55298503-55298525 TACATTAAGCAGGAGACAGATGG + Intronic
1149333107 17:55606805-55606827 TTTAAGAAGCAGGAGGAAGGAGG - Intergenic
1149410609 17:56402228-56402250 TTCCATAAGATAGAGAAAGAAGG - Intronic
1149434884 17:56625142-56625164 TTCCATAAGCCTGAGAATGAGGG - Intergenic
1150328460 17:64275416-64275438 TTGATTATGCAGGAGAAAGGGGG - Intergenic
1150683802 17:67304228-67304250 TCCATTAAGAAGGAGGAAGACGG + Intergenic
1151079145 17:71308354-71308376 TTCCAAAAGATGGAGAAAGAGGG + Intergenic
1152164619 17:78694481-78694503 TTAAATAAGGAGGATAAAGAAGG + Intronic
1152383475 17:79954686-79954708 TTCAATGAGCAGATGACAGAAGG - Intronic
1152601945 17:81267503-81267525 GTGAGTTAGCAGGAGAAAGAAGG - Intronic
1152961723 18:84075-84097 GCCAGTCAGCAGGAGAAAGATGG + Intergenic
1153425375 18:4957318-4957340 TTCCAAAAGATGGAGAAAGAGGG + Intergenic
1153525720 18:5992724-5992746 TTACAAAAGCAGGAGCAAGAGGG - Intronic
1154083114 18:11277311-11277333 TTCCATCAGTAGGAGAAAGTTGG - Intergenic
1155286781 18:24297035-24297057 TTCCAAAAGAAAGAGAAAGAAGG - Intronic
1155641119 18:28016367-28016389 TTCAAAAAGTAGGAAACAGATGG + Intronic
1156145357 18:34169411-34169433 TTTAATGTGCAGGAAAAAGAAGG + Intronic
1156627868 18:38931517-38931539 TTCAAAGAGCAGGAGAATAAAGG + Intergenic
1156748001 18:40415956-40415978 TTCAATAGACAGGAGAACAAAGG - Intergenic
1157218885 18:45810320-45810342 TTCCACAAGATGGAGAAAGAAGG + Intergenic
1157254729 18:46128576-46128598 TTAAATCAGTAGTAGAAAGATGG + Intergenic
1157465226 18:47938333-47938355 GACAATAAGCAGAAGAAACAAGG + Intergenic
1157640402 18:49207022-49207044 TTTAAAAATGAGGAGAAAGATGG - Intronic
1158094233 18:53752865-53752887 TTCGATAGGCAGGAGACAGTAGG - Intergenic
1158804320 18:60951397-60951419 TTTAATAATCAGAAGAAAGAAGG + Intergenic
1159053675 18:63444532-63444554 TTGAATAAACAGGAAAAAAAAGG - Intergenic
1160491919 18:79345201-79345223 TTCCCTAGGCAGGAGAAGGATGG + Intronic
1162228458 19:9244491-9244513 TTCAAAATGCAGAAGAATGAAGG + Intergenic
1162492976 19:11005445-11005467 AACCATCAGCAGGAGAAAGAAGG - Intronic
1162829995 19:13278424-13278446 GTCATAAAGGAGGAGAAAGACGG - Intronic
1164174809 19:22762593-22762615 TTCCATAAGATAGAGAAAGAGGG + Intronic
1164359226 19:27483294-27483316 TTCAATGAAAAGTAGAAAGACGG + Intergenic
1164983590 19:32631942-32631964 GTCAACCAGCAGGAGAGAGAGGG + Intronic
1166935023 19:46326758-46326780 TTCAAAAAGGAGGGGTAAGAGGG + Intronic
1167867164 19:52337583-52337605 GAAAAAAAGCAGGAGAAAGAAGG + Intronic
1168095306 19:54111076-54111098 TTGAATAAGGAGGAGACAAAGGG + Intronic
1168673751 19:58261204-58261226 TTCATTAATCATGAGAAAAATGG + Exonic
924997148 2:372576-372598 ATAACTAAGGAGGAGAAAGAAGG + Intergenic
925201139 2:1968588-1968610 TTCCCTCAGCAGGAGACAGAGGG + Intronic
925263480 2:2547857-2547879 TGCAGAAAGCAGGATAAAGATGG - Intergenic
925594556 2:5542649-5542671 TGCACTGAACAGGAGAAAGATGG + Intergenic
925922701 2:8647854-8647876 TTCAGCAAGCAGCAGAAAGGAGG - Intergenic
926865838 2:17357376-17357398 TGAAATAGGCAGCAGAAAGATGG - Intergenic
927527265 2:23756610-23756632 TTTAAGAAGCAGCAGAAAGAGGG - Intronic
927626917 2:24731192-24731214 TTCAGGAAGGAAGAGAAAGAAGG + Intronic
927667907 2:25044846-25044868 TCCCATAAGCAGAAGGAAGAAGG - Intronic
928019472 2:27691074-27691096 TTCCAAAAGAATGAGAAAGAAGG - Intronic
928399656 2:30968801-30968823 TTAGATAAGCAGTAGAAAAAGGG + Intronic
929396070 2:41523751-41523773 TTCAAGAGGCAGCATAAAGAGGG + Intergenic
930156990 2:48115990-48116012 TTCAGTAAGCAGGGGAACCAAGG - Intergenic
930163147 2:48178362-48178384 TTCATTAAGAAAGGGAAAGAGGG + Intergenic
930720646 2:54634446-54634468 ATCAATAAGCATAATAAAGATGG + Intronic
931773045 2:65515975-65515997 TTCCTTTATCAGGAGAAAGATGG + Intergenic
933386004 2:81610982-81611004 CTCAAAAAGCAGCAGGAAGAAGG + Intergenic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
933845956 2:86327536-86327558 TTTAAACAGCAGGGGAAAGATGG + Intronic
934607431 2:95707478-95707500 TTCAATAAGGAGGACCAAGATGG + Intergenic
936022398 2:109004875-109004897 TTCAATAATTAGGAGAGGGAGGG - Intergenic
936540831 2:113349663-113349685 TTCAATAAGGAGCACCAAGATGG + Intergenic
936633717 2:114232687-114232709 TTCCAGAAGCTAGAGAAAGAGGG - Intergenic
936861632 2:117027072-117027094 TGTAATAAGCAGGAGGAACAGGG - Intergenic
937068949 2:119047187-119047209 TTCCACAAGAAAGAGAAAGAAGG - Intergenic
937497453 2:122436732-122436754 TAAAATAAGCTGGAGAAAAAAGG + Intergenic
938400439 2:130986824-130986846 TGCCAAAAGCAGGAGAAAGAAGG - Intronic
939298159 2:140297019-140297041 GTCATAAAGCAGGAGAAAAAGGG + Intronic
939501292 2:142988168-142988190 TACAATATACAGGAAAAAGATGG + Intronic
939769855 2:146301978-146302000 TTCCACAAGATGGAGAAAGAAGG + Intergenic
940802547 2:158148889-158148911 TTCCATAAGATAGAGAAAGAGGG + Intergenic
941094133 2:161216328-161216350 TTCAATTAGCAGAAGCAAGAAGG - Intronic
941310074 2:163916807-163916829 TTGAATAAGCAAGAGTAACAGGG + Intergenic
943631449 2:190257382-190257404 TAAAATAAGCAGAAGAAAGGAGG + Intronic
943812990 2:192212709-192212731 TTCACTAAGCAGGAAAATAATGG + Intergenic
944431743 2:199641201-199641223 TTCCACAAGCTAGAGAAAGAGGG - Intergenic
944739358 2:202596540-202596562 TTCAGTAAGTGGGAGAATGATGG + Intergenic
944852809 2:203737049-203737071 TTCAAGAAACAGGAAAATGATGG - Exonic
945201805 2:207289312-207289334 GTCATTCAGCAGGAGCAAGAGGG + Intergenic
945538138 2:211046311-211046333 GGCAATAAGCAGAAGCAAGAAGG + Intergenic
945548478 2:211188558-211188580 TTTATCAAGGAGGAGAAAGAAGG + Intergenic
945877694 2:215295520-215295542 TTCAATAAGAACCAAAAAGAGGG + Intergenic
946935027 2:224711031-224711053 TTCTAGAATCAGGAGTAAGAAGG - Intergenic
947867416 2:233408847-233408869 TTAAAGAAGCAGGAGGAAGCAGG + Intronic
948331829 2:237174144-237174166 TTGAAAAAGCAGAAGAAAGCTGG - Intergenic
948374101 2:237509627-237509649 TTCAAAAACCAAGAGAAAAAGGG - Intronic
948997928 2:241593428-241593450 ATGAATCCGCAGGAGAAAGATGG + Intronic
1168848948 20:963630-963652 TTCATTAAGAATGATAAAGAGGG + Intronic
1170720738 20:18876214-18876236 TTCCATAAGATAGAGAAAGAAGG - Intergenic
1172834930 20:37867275-37867297 TTAAAAATGCAGGAGGAAGAGGG - Intronic
1173114418 20:40226745-40226767 CTCTATAAGGAGGAGAAACATGG + Intergenic
1173198379 20:40934728-40934750 GTCAATTAGATGGAGAAAGAAGG + Intergenic
1173403294 20:42743619-42743641 TCTAATTAGCAGGAGAATGAAGG + Intronic
1174981274 20:55397982-55398004 TTCTATAAACTGGAGAAAGGAGG - Intergenic
1175000147 20:55618938-55618960 TTCCACAAGCTAGAGAAAGAGGG - Intergenic
1176885342 21:14248694-14248716 TACAACAAGCATGAGAAACAGGG - Intergenic
1177107629 21:16979572-16979594 TTTTATAAGCAGAAGCAAGAGGG + Intergenic
1177754785 21:25333253-25333275 TTCAAAAAGCAAGAGAAGAAGGG + Intergenic
1177965988 21:27726606-27726628 GTTAGTAAGCAGGAGAAAGAAGG + Intergenic
1180664477 22:17498931-17498953 TTCAATCAGCATAAGAAACACGG - Intronic
1181394246 22:22607954-22607976 TTCACAAAGCAGTACAAAGAAGG + Intergenic
1181936640 22:26443356-26443378 TACAATAACCAAGGGAAAGAGGG - Exonic
1183372454 22:37441552-37441574 ATGAAAATGCAGGAGAAAGAGGG - Intergenic
1184221752 22:43105302-43105324 TAAAATAAGCAGGAGAAGAAGGG + Intergenic
1184436435 22:44481010-44481032 TAAATTAAGCAGAAGAAAGAGGG + Intergenic
1185183953 22:49381472-49381494 TTTCAGAACCAGGAGAAAGATGG - Intergenic
950484435 3:13264698-13264720 TTCAACAAGCGGGAGGAGGACGG + Intergenic
950792883 3:15487565-15487587 TTCCATGGGGAGGAGAAAGAGGG - Intronic
950956584 3:17059865-17059887 GTCAAAAAGAAGGAGAAACATGG + Intronic
950972736 3:17204906-17204928 TGCAAAAAGATGGAGAAAGAAGG + Intronic
951097359 3:18647602-18647624 TTTAAAATGCAGGAGAAAGTAGG + Intergenic
951264008 3:20546577-20546599 TTCAATAAACAGTAAGAAGATGG - Intergenic
951781476 3:26368069-26368091 ATCCATAAGCAGAAGAAAGGAGG + Intergenic
951852243 3:27154403-27154425 TTCCATAAGATAGAGAAAGAGGG + Intronic
952226803 3:31385964-31385986 CTCAATAAGCAGGAAAAAAGTGG - Intergenic
952356409 3:32588974-32588996 TACAATTAGCAAGAGATAGAGGG - Intergenic
952670676 3:35963676-35963698 TGGAATAAGCAGGAGGAAGAAGG + Intergenic
953243448 3:41169606-41169628 TCCAGTAAGCAGGAGACACAGGG - Intergenic
953405727 3:42658917-42658939 TTCTTTAAGGAGGAGAAGGAGGG + Exonic
953496521 3:43392108-43392130 TTAAATAATCAGGAGACAGGAGG - Intronic
954554713 3:51508774-51508796 TCCAATAGGCAGGAGACAGGAGG + Intergenic
955175345 3:56608168-56608190 TTCCACAAGATGGAGAAAGAAGG - Intronic
956555875 3:70521788-70521810 TTCAAAAATGAGGAGACAGAGGG - Intergenic
956913695 3:73848541-73848563 TTCAATAATCAGGAGCATGAGGG - Intergenic
957459825 3:80501891-80501913 CTAAATGTGCAGGAGAAAGAAGG - Intergenic
957766597 3:84633312-84633334 TTGATGAATCAGGAGAAAGAGGG - Intergenic
958003012 3:87775150-87775172 TTCCATAAGATAGAGAAAGAAGG - Intergenic
958190920 3:90183772-90183794 TTCAATAAAAAAGGGAAAGAAGG - Intergenic
958413123 3:93842907-93842929 TTCAATAAAAAAGGGAAAGAAGG - Intergenic
958812049 3:98871809-98871831 TTCTAAAAGATGGAGAAAGAGGG - Intronic
958966326 3:100562869-100562891 TTCCAGAAGAAGGTGAAAGATGG + Intronic
959782305 3:110249076-110249098 GTCACTAAGATGGAGAAAGAAGG - Intergenic
962100178 3:132333618-132333640 TTCAAGAAACAGCAGAAAAATGG - Intronic
964073761 3:152667668-152667690 ATCAATAAGTTGGAGAAAGGAGG - Intergenic
964342538 3:155722856-155722878 TTCCAAAAGCTAGAGAAAGAGGG - Intronic
964916039 3:161843232-161843254 TTCCATAAGACAGAGAAAGAAGG - Intergenic
965094527 3:164207806-164207828 TTCAATAAGTAGGAAGTAGAGGG + Intergenic
965154303 3:165027410-165027432 TTCCACAAGAAAGAGAAAGAGGG + Intronic
965236562 3:166132088-166132110 TTCAATAAACTGGAGAGAGAAGG - Intergenic
965552349 3:169980171-169980193 TTGAATAAGGAAGAGAGAGATGG + Intronic
965621221 3:170644060-170644082 TGCATTAAGCAGGTGGAAGAAGG + Intronic
966275257 3:178157873-178157895 CTCAAAAAGCAGGAGAAATTAGG + Intergenic
966313370 3:178618698-178618720 TATAAAAAGCAGTAGAAAGATGG - Intronic
967408326 3:189141956-189141978 TGCAATAAGGATGACAAAGATGG + Intronic
967510093 3:190301143-190301165 TCCAGTAAGCAGTAGAAAAACGG - Intergenic
968914165 4:3489913-3489935 ATGAATGAGCAGGAGACAGAAGG - Intronic
968914442 4:3491156-3491178 ATGAATGAGCAGGAGGAAGAAGG - Intronic
970455212 4:16216733-16216755 TGCAATAACCTGGAGAGAGATGG - Intronic
970480818 4:16472122-16472144 TTCAATAAGCTGGAGAAGCTGGG - Intergenic
970792450 4:19874772-19874794 TTTAATAGTCAGGAGAGAGAAGG + Intergenic
971356982 4:25903920-25903942 TTCCAAAAGCAGGAGAAGAAGGG + Intronic
972036014 4:34521941-34521963 GTCAATAAGCACATGAAAGATGG - Intergenic
972602955 4:40588793-40588815 GTTAATAAGCAGGAGCAACAAGG + Intronic
974607302 4:64169996-64170018 TTCTATAAACTGAAGAAAGAAGG + Intergenic
975083595 4:70309796-70309818 ATTAATAAACAGGAGAAATAGGG + Intergenic
975335683 4:73172331-73172353 TTAAACATGAAGGAGAAAGAGGG + Intronic
975931740 4:79532674-79532696 TACAATGATGAGGAGAAAGAGGG + Intergenic
976847433 4:89505970-89505992 TTCATTAAGAAGGAAAAAGGAGG - Intergenic
977474212 4:97484667-97484689 TTCCATAAGATAGAGAAAGAGGG + Intronic
977787718 4:101058040-101058062 TTAAATAAGATGGAGAAAAAAGG + Intronic
977953227 4:102998275-102998297 TGCAATAAGCAAGACAAAAAAGG - Intronic
978316646 4:107445170-107445192 TTCCACAAGATGGAGAAAGAGGG - Intergenic
978595905 4:110376899-110376921 GTGAAAAAGAAGGAGAAAGAAGG - Intronic
978747891 4:112214747-112214769 ATAAATTGGCAGGAGAAAGAGGG + Intergenic
978825220 4:113014694-113014716 TACAATAACTTGGAGAAAGATGG - Intronic
979535496 4:121815528-121815550 ACTAATAAGCAGGAGAAAAATGG + Intronic
979584575 4:122400539-122400561 TTCCAAAAGATGGAGAAAGAGGG - Intronic
980174414 4:129327166-129327188 GTAAACATGCAGGAGAAAGAGGG - Intergenic
980461368 4:133119027-133119049 TTCTATAAGAATGAGAAACAGGG - Intergenic
980837313 4:138211575-138211597 TGCAATAAACATGAGAAAGCAGG - Intronic
981120033 4:141039301-141039323 TTTCTTTAGCAGGAGAAAGAAGG + Intronic
981952685 4:150429191-150429213 TTAAATAGGGAGGAGAGAGAAGG + Intronic
981966355 4:150608340-150608362 TTGAAAGGGCAGGAGAAAGATGG + Intronic
982189466 4:152839315-152839337 TTCCATAAGAGAGAGAAAGAAGG - Intronic
982218463 4:153103933-153103955 TTCCACAAGATGGAGAAAGAGGG - Intergenic
982531695 4:156552831-156552853 TTCCACAAGATGGAGAAAGAGGG - Intergenic
983789592 4:171779940-171779962 TTTAATAAGCCGGAAAAATATGG - Intergenic
984226982 4:177046889-177046911 TTCAATAAGGATGAGAAGAAAGG + Intergenic
984481887 4:180314853-180314875 TTCAACATGGAAGAGAAAGAAGG + Intergenic
984766289 4:183402937-183402959 TTCCATAAAGGGGAGAAAGATGG - Intergenic
985174984 4:187191260-187191282 TTCCATAAGCTGGGAAAAGAAGG - Intergenic
985239307 4:187913090-187913112 TTCAACAATAAGGAGAAAGGAGG + Intergenic
987004524 5:13696148-13696170 GTCACTAAGCAGGTGCAAGAGGG - Intronic
987024539 5:13910885-13910907 TGCAGTGAGCAGGTGAAAGAAGG + Intronic
987317123 5:16734155-16734177 TCCAAGAAGCAGCAGACAGAAGG + Intronic
987675350 5:21066177-21066199 TTGTAAAAGCAGGAGGAAGAGGG - Intergenic
988532202 5:32037670-32037692 TTCAATAAGCAGGAGAAAGATGG + Intronic
988558493 5:32259493-32259515 CTCAATAAATAGGAGACAGAAGG - Intronic
988618976 5:32803102-32803124 TTTAATAGACAGGAGAAAGGAGG - Intergenic
989141373 5:38204762-38204784 AGCAGAAAGCAGGAGAAAGAGGG - Intergenic
989563904 5:42881958-42881980 TTCTATTAGCAGAAGAAGGAGGG - Intronic
990372300 5:55132530-55132552 TTTTTGAAGCAGGAGAAAGAAGG - Intronic
991230512 5:64328018-64328040 TTCCAGAAGGAGGAGGAAGAGGG + Intronic
991684886 5:69172700-69172722 TTTAAAAAGCACTAGAAAGATGG - Intronic
991948614 5:71926220-71926242 TTCAATAGGCAAGAGACAAAGGG + Intergenic
992952258 5:81871590-81871612 TTTAATAATTAGGATAAAGAAGG + Intergenic
993076386 5:83237251-83237273 TGCAATAAGCATGAGAATAAAGG - Intronic
993302989 5:86236867-86236889 TTCAACAAGTAGAAAAAAGATGG - Intergenic
993401672 5:87460928-87460950 TTCCACAAGCTAGAGAAAGAGGG + Intergenic
993766957 5:91871852-91871874 TTGAAAAAGTAAGAGAAAGAAGG - Intergenic
993917353 5:93759352-93759374 TTCCATAAGATAGAGAAAGAAGG + Intronic
993948279 5:94141079-94141101 TTCCATAAGATAGAGAAAGAGGG - Intergenic
993972732 5:94440124-94440146 TTCAAAATGCAAGATAAAGATGG + Intronic
994043212 5:95281615-95281637 TTCAAAAAATAAGAGAAAGATGG - Intronic
994064471 5:95521500-95521522 TTCTTTAAAAAGGAGAAAGAAGG + Intronic
995401053 5:111742059-111742081 TTCAATAAGGAAGACAATGATGG + Intronic
996809390 5:127498250-127498272 TTAAATAAGCAAGAGAGAGAGGG + Intergenic
997089204 5:130837001-130837023 TTTAACAAACAGGAGAGAGATGG + Intergenic
997763655 5:136476415-136476437 TTCCATAAGATAGAGAAAGAGGG - Intergenic
998361190 5:141589191-141589213 AAGAATAAGCATGAGAAAGAAGG + Intronic
999240106 5:150122462-150122484 CTCTATAGGCAGGAAAAAGATGG + Intronic
999339723 5:150759525-150759547 TTCAATAAGTATGAAAAGGAGGG + Intergenic
999379358 5:151109540-151109562 TTCCCTAAGGAGGAGAAAGAAGG + Intronic
1002546798 5:179952808-179952830 TTCAATAAGCTAGAAATAGAAGG + Intronic
1003024894 6:2545764-2545786 TTTATCAAGCAGGAGAAAGAAGG + Intergenic
1003316225 6:5014456-5014478 TACCATAAGCAGGAGAACCAAGG - Intergenic
1003538960 6:7001571-7001593 TTCAATAAGCAGGAGGCTGTTGG - Intergenic
1003711690 6:8599495-8599517 TTCCATAAGATAGAGAAAGAAGG - Intergenic
1004071507 6:12302213-12302235 TGCAATAGGAAGGAGCAAGAGGG + Intergenic
1004127372 6:12886869-12886891 TTCAAAAAACAGTAGCAAGAGGG + Intronic
1004237414 6:13886597-13886619 TTCAATAAGGGAAAGAAAGAAGG + Intergenic
1004785468 6:18963389-18963411 TTCAAAGAGCAGGAGATAAAGGG + Intergenic
1006145573 6:31957336-31957358 TTCAATATGCAGGAAATAGATGG - Intronic
1007080539 6:39099389-39099411 TTAAATTAGCAGGAAAGAGATGG + Intergenic
1007257746 6:40540662-40540684 TTCATTATGAAGGAGAAACACGG + Intronic
1007498435 6:42277839-42277861 ATAAATAAGAAGAAGAAAGAAGG + Intronic
1008524001 6:52389412-52389434 TTCAATAAGCAGAAGAGAGAAGG + Intronic
1008726838 6:54431846-54431868 TTCACTAAGGAAGTGAAAGAAGG + Intergenic
1009228337 6:61037222-61037244 TTTAATATTCAGGGGAAAGAGGG - Intergenic
1009369746 6:62883638-62883660 CTCAATATGTAGGCGAAAGAGGG + Intergenic
1009615995 6:66008262-66008284 GTCAATAAGAAAAAGAAAGAAGG - Intergenic
1009969315 6:70609789-70609811 TTCCACAAGAAAGAGAAAGAAGG + Intergenic
1010186966 6:73156173-73156195 TACAACCAGCAGCAGAAAGAAGG + Intronic
1010304018 6:74296109-74296131 TTCAATAATAAGGAGTAGGAAGG - Intergenic
1010481915 6:76365622-76365644 CTCAATAAACTGGAGATAGAAGG - Intergenic
1010518085 6:76799361-76799383 TTCAAAAAGATAGAGAAAGAGGG - Intergenic
1010666649 6:78638665-78638687 TTCATCCAGCAGGAGACAGAAGG + Intergenic
1010716783 6:79239344-79239366 TTTAAGCAGCAGGAGCAAGAAGG - Intergenic
1010870759 6:81035189-81035211 TGGAATAAGGAGGAGAGAGAGGG - Intergenic
1011253822 6:85401346-85401368 TTTAAGAAGCAGAAGAGAGAGGG + Intergenic
1011328790 6:86180703-86180725 TTCCATAAGATAGAGAAAGAAGG - Intergenic
1013900711 6:115153046-115153068 TTCCACAAGATGGAGAAAGAAGG - Intergenic
1015778069 6:136834718-136834740 TTGAAAATTCAGGAGAAAGATGG + Intronic
1015801882 6:137068708-137068730 TTCAATAAGGAGGAAATACAAGG + Intergenic
1016714566 6:147209906-147209928 TTGAGTTAGCAGGAGAAATAAGG + Intronic
1016994043 6:149948308-149948330 CTCAAGAAGAAGGGGAAAGAAGG + Intronic
1017004296 6:150019249-150019271 CTCAAGAAGAAGGGGAAAGAAGG - Intronic
1017868931 6:158469812-158469834 TTTAACAAGCAGCAGAAGGAAGG + Intronic
1018947234 6:168356403-168356425 TTTAAAAAGAAGCAGAAAGAAGG - Intergenic
1019073023 6:169365581-169365603 TCCAATAATCAGGAAGAAGAGGG + Intergenic
1020595613 7:10203725-10203747 TGAAATTAGCAGAAGAAAGAGGG + Intergenic
1020689433 7:11336762-11336784 TTTAATAAGAAGGAGAACAAGGG - Intergenic
1021384324 7:20009293-20009315 TTTAATAAGCATAAGACAGAAGG + Intergenic
1021588135 7:22232048-22232070 GGCAATGAGCAGGAGAAACATGG + Intronic
1021626479 7:22598425-22598447 TTCACTAAGGAGGAGACAAATGG + Intronic
1021773747 7:24031059-24031081 TGCAATAAGGAGGGGAAAGTTGG + Intergenic
1022188345 7:27991856-27991878 GTCAATAAGCAGCAGATATAAGG + Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1024611666 7:51070049-51070071 CTTAATAAGAAGGAAAAAGAAGG + Intronic
1027656825 7:80940734-80940756 TGGAAAAAGCAGAAGAAAGAAGG + Intergenic
1028083543 7:86606292-86606314 TTCTATAAGGAGTAGAAAAATGG - Intergenic
1028182731 7:87745352-87745374 TTCCATAAGATAGAGAAAGAAGG - Intronic
1028292453 7:89082666-89082688 TTTAATAAGAAGGAGAATAATGG - Intronic
1028943043 7:96546570-96546592 TTAATTGAGCAGGAGAAAGAAGG + Intronic
1029301478 7:99585167-99585189 TTCAATATCCAGGAGAAAAGAGG - Intronic
1029587193 7:101482309-101482331 ATCAATAAAAAGGAAAAAGAAGG - Intronic
1029675591 7:102066279-102066301 TCCAATAAGGAGGAGAAACCTGG - Intronic
1030435974 7:109521107-109521129 TTTCATAAGCATGAAAAAGAAGG - Intergenic
1030507002 7:110437197-110437219 TACAAAAAGCAGGAGGAAGAAGG + Intergenic
1031344460 7:120648497-120648519 GTCAACAAGATGGAGAAAGATGG + Intronic
1032297589 7:130655096-130655118 ATCTATAAACAGGAGAAAAATGG - Intronic
1032445400 7:131978227-131978249 TTAAATGTGCAGGAAAAAGAAGG - Intergenic
1033516442 7:142111357-142111379 TTTAATAAGTAAGTGAAAGAAGG - Intergenic
1034315377 7:150126280-150126302 GTCAATGTGCAAGAGAAAGAGGG - Intergenic
1034791516 7:153974514-153974536 GTCAATGTGCAAGAGAAAGAGGG + Intronic
1035410300 7:158634726-158634748 TTCCAGTAGCAGGAGAAAAATGG - Intronic
1035853641 8:2948122-2948144 TTCTACAAGTAGGAGAAATATGG + Intronic
1037005115 8:13768476-13768498 TGAAATAAGCATGAGAATGAAGG + Intergenic
1037098254 8:15012076-15012098 TTCATTAATAAGGACAAAGATGG - Intronic
1037560301 8:20067726-20067748 TTCCATAAGATAGAGAAAGAAGG - Intergenic
1037654141 8:20868454-20868476 TTTAAAAGGCAGGAGAAAAATGG + Intergenic
1037690408 8:21177020-21177042 TTCAACAAGCAGGAGAACAAAGG + Intergenic
1038092092 8:24266215-24266237 TTTAAAAAGTAAGAGAAAGAAGG + Intergenic
1038109891 8:24484231-24484253 TTCAATAATAAAGAGAAAAATGG + Intronic
1038333895 8:26631071-26631093 TGCAGAAAGCAGGAGAAAGAAGG - Intronic
1038366951 8:26946151-26946173 TTCCATAAGACAGAGAAAGAAGG - Intergenic
1038878672 8:31581884-31581906 TAAAATAAGCAGGAGTAAAAAGG - Intergenic
1039188763 8:34947991-34948013 CTCAATCAGCGGGAGGAAGAAGG + Intergenic
1039204780 8:35140095-35140117 TTCATGATGCCGGAGAAAGAGGG - Intergenic
1039242951 8:35576567-35576589 TTCAATAAGTAGGTGAGATATGG + Intronic
1039605789 8:38879285-38879307 TTAAATAAGCAGGTAAAATAGGG - Intergenic
1041931826 8:63295490-63295512 TTCAAAAACCAGGACAAAAAGGG - Intergenic
1042068298 8:64902849-64902871 TAGAATAAAAAGGAGAAAGAAGG + Intergenic
1042305624 8:67328839-67328861 TTTGAAAAGAAGGAGAAAGAAGG + Intronic
1042534004 8:69840778-69840800 TTCAATAAGCAGAAGCAGCAAGG - Intergenic
1043166763 8:76912037-76912059 TTCATGAAGAAGAAGAAAGATGG - Intergenic
1043171676 8:76973513-76973535 TTCAGCAGGCAGGAGAAAGAAGG + Intergenic
1043245444 8:77994036-77994058 TCCAATAAGTAAGAGAAAAAAGG - Intergenic
1043840528 8:85098361-85098383 TTCATTAAGCAGAAGTAAAAGGG + Intergenic
1045179602 8:99766027-99766049 CCAAATAAGTAGGAGAAAGACGG - Intronic
1045255008 8:100512055-100512077 TTCAATCAGTAGGAGAAAGGGGG + Intronic
1045736328 8:105299936-105299958 TACAATACACAGGAGACAGAGGG - Intronic
1045815979 8:106276665-106276687 TTAAATAAACAGAAGAAACATGG - Intronic
1045868905 8:106902948-106902970 ATAAAAAAGCAGGAGAGAGAAGG - Intergenic
1045923721 8:107563858-107563880 TTAAATAAGCAATAGAAAAAGGG - Intergenic
1046341303 8:112859834-112859856 TTTATTAAGTAGAAGAAAGATGG - Intronic
1046345969 8:112927473-112927495 TTGAATATTCAAGAGAAAGAAGG - Intronic
1046430699 8:114123675-114123697 TTCCATAAGCAGGAGAGACATGG + Intergenic
1046674359 8:117092451-117092473 TTCAAAAGACAGGAAAAAGAGGG - Intronic
1047679554 8:127240428-127240450 TTCAATAATGAGTAGAAAAATGG + Intergenic
1049236793 8:141516164-141516186 ATCATGATGCAGGAGAAAGAGGG - Intronic
1050282068 9:4060786-4060808 TTTAATAAGCAACAGAAAAATGG + Intronic
1051399468 9:16664059-16664081 TTCGAGAAGCAGGATAAAGGTGG - Intronic
1053292354 9:36889629-36889651 GTCTAGAAGCAGGAGAAGGATGG - Intronic
1053836455 9:42141416-42141438 TTCCAGAAACAGGAGAAAGAAGG + Intergenic
1054741961 9:68815318-68815340 TTTAAGAATCAGAAGAAAGAAGG + Intronic
1055125052 9:72709397-72709419 TTCCACAAGAAAGAGAAAGAGGG - Intronic
1055321260 9:75085657-75085679 TTCAGGAACCAGGAGTAAGATGG + Intronic
1056524601 9:87431664-87431686 GTCAATAAGCAAGCTAAAGATGG + Intergenic
1056658531 9:88528001-88528023 TTCAAAAAGCAGGAAAAGAATGG - Intergenic
1057007272 9:91571512-91571534 TTCATTCAGCAGGAAAGAGAGGG + Intronic
1057151869 9:92803307-92803329 TTCATTAAGATGGACAAAGATGG - Intergenic
1057476005 9:95402618-95402640 TTCCATAAGACAGAGAAAGAAGG + Intergenic
1057563002 9:96143076-96143098 ATCATTAAGCAGGAAAAAGTTGG - Intergenic
1058938504 9:109791531-109791553 TTCAGAAAGCAAGGGAAAGATGG + Intronic
1059073074 9:111160027-111160049 TTGAAGATGCAGGAGAGAGAGGG - Intergenic
1059359244 9:113727289-113727311 TCCAATAAGCAGGGGCAAAAAGG - Intergenic
1061227050 9:129286513-129286535 CTCAATAAACAGGAGATCGATGG - Intergenic
1061428320 9:130515278-130515300 TAATATAAGCGGGAGAAAGATGG + Intergenic
1062210983 9:135363924-135363946 TCCAATTAGCAGGAGAGAGCAGG - Intergenic
1062736428 9:138140029-138140051 GCCAGTCAGCAGGAGAAAGATGG - Intergenic
1186264559 X:7818532-7818554 TGCAAGAAGGAGGAGAAGGAGGG + Intergenic
1187552406 X:20319091-20319113 GTCTAGAAGCAGAAGAAAGAGGG + Intergenic
1187583991 X:20639642-20639664 ATCACAAAGCAGGGGAAAGAAGG + Intergenic
1187661913 X:21556930-21556952 TTGATGATGCAGGAGAAAGAAGG + Intronic
1188519188 X:31018903-31018925 TGCAATAAGCAGGTGAGAGATGG - Intergenic
1188577171 X:31665613-31665635 TTCAGTAAGCCGGAAAATGAGGG - Intronic
1188659850 X:32745401-32745423 TTCAAAAGACAAGAGAAAGATGG - Intronic
1188695969 X:33191213-33191235 TTCTAAAAGCAGGTGTAAGAGGG - Intronic
1189178935 X:38985000-38985022 GTCAGAAAGAAGGAGAAAGAGGG + Intergenic
1189413957 X:40798048-40798070 TTCCATAAGATAGAGAAAGAAGG + Intergenic
1189971086 X:46418944-46418966 TTCCATAAAGAGGGGAAAGATGG + Intergenic
1190444713 X:50512657-50512679 TTCAATAAGGAGGAAATAAAAGG + Intergenic
1191667304 X:63716638-63716660 TTCAATAAGCAGGTAAAGCATGG - Intronic
1191778175 X:64841151-64841173 TTCCACAAGAAAGAGAAAGAAGG - Intergenic
1192460331 X:71311565-71311587 TTGAATAAACAGGAGAGAGAAGG - Intergenic
1192564573 X:72153058-72153080 TTCAAGAAGAAGCAGAAAGTAGG + Intergenic
1193817431 X:86121188-86121210 TTGAACAAGCAGAAAAAAGAAGG - Intergenic
1195009058 X:100717404-100717426 CTGGATAAGCAGGAGAACGAGGG + Intronic
1195066977 X:101246121-101246143 GTCAATAAGCAGGTGGGAGAGGG + Intronic
1195975958 X:110527044-110527066 TTCCACAAGATGGAGAAAGAGGG + Intergenic
1196659608 X:118256150-118256172 TTCAATATACATAAGAAAGAAGG + Intergenic
1197102774 X:122676111-122676133 TTCCATAAGACAGAGAAAGAGGG + Intergenic
1197114170 X:122812657-122812679 TAGACTAAGGAGGAGAAAGAAGG - Intergenic
1197132752 X:123023589-123023611 TTCCATAAGATAGAGAAAGAAGG + Intergenic
1197911274 X:131485273-131485295 TTCCACAAGAAAGAGAAAGAGGG + Intergenic
1199048994 X:143212931-143212953 TTCCATAAGATAGAGAAAGAAGG - Intergenic
1199059817 X:143341641-143341663 TTCAAAATGCAGAAGGAAGATGG - Intergenic
1199345867 X:146738673-146738695 TTCAATTAGCAGGAAGAAGGCGG - Intergenic
1199668844 X:150124419-150124441 TTCCACAAGAAAGAGAAAGAAGG + Intergenic
1200398666 X:156006134-156006156 GCCAGTCAGCAGGAGAAAGATGG - Exonic
1201333175 Y:12849979-12850001 TCCAATCAGCAGAAAAAAGAGGG - Intronic
1201466632 Y:14288584-14288606 TTAAATGTGCAGGAGACAGAAGG + Intergenic
1202103660 Y:21338535-21338557 TAAAATGAGCAGGGGAAAGATGG + Intergenic