ID: 988536779

View in Genome Browser
Species Human (GRCh38)
Location 5:32075492-32075514
Sequence AACCTTGCTGTGGTATCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988536776_988536779 18 Left 988536776 5:32075451-32075473 CCAAATTTCTACATTGGTTATAT 0: 1
1: 0
2: 2
3: 34
4: 380
Right 988536779 5:32075492-32075514 AACCTTGCTGTGGTATCATATGG 0: 1
1: 0
2: 0
3: 12
4: 149
988536774_988536779 30 Left 988536774 5:32075439-32075461 CCTTATATTTTTCCAAATTTCTA 0: 1
1: 0
2: 6
3: 101
4: 946
Right 988536779 5:32075492-32075514 AACCTTGCTGTGGTATCATATGG 0: 1
1: 0
2: 0
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988536779 Original CRISPR AACCTTGCTGTGGTATCATA TGG Intronic
906766738 1:48440858-48440880 AACCTTGGTGTTCTATAATAGGG + Intronic
907228671 1:52974326-52974348 AACTTTTCTGTTTTATCATAAGG + Intronic
907382639 1:54103935-54103957 TCCTTTGCTGTGGAATCATATGG - Intronic
910314350 1:85865600-85865622 TTCCTTGCTGTGGTATTCTACGG + Intronic
910773961 1:90856438-90856460 AATCTTGCTGTGGTACAATGTGG + Intergenic
914933482 1:151956432-151956454 AACCTTGATGTTTTAACATAGGG - Intergenic
915854199 1:159363723-159363745 AGCCTTTCTTTGGTATCAAAAGG + Intergenic
917086190 1:171307721-171307743 AACCTTGGTGTTCTATAATAGGG + Intergenic
917445737 1:175104646-175104668 AACCTTGGTGTTCTATAATAGGG - Intronic
917665940 1:177225875-177225897 AACCTGGCCTTGGAATCATATGG - Intronic
917676334 1:177322481-177322503 AACCTTGGTGTTCTATAATAGGG + Intergenic
918245302 1:182654194-182654216 GACCTTGCTTTGGAGTCATATGG - Intronic
918508292 1:185281946-185281968 ACCCTTGCTGTGGCATTACATGG + Intronic
918750118 1:188260857-188260879 AACCTTGGTGTTCTATAATAGGG - Intergenic
921969113 1:221125807-221125829 AACTTGACTGTGGAATCATAGGG + Intergenic
1065538547 10:26738056-26738078 AACCTTGCTGTTTTATTAGAAGG - Intronic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1068240711 10:54298337-54298359 AACCTTGGTGTTCTATAATAGGG + Intronic
1068500374 10:57835549-57835571 AACCTTGGTGTTCTATCATAGGG + Intergenic
1073993835 10:109293744-109293766 CAGCTTGCTCTGGTATCATCTGG - Intergenic
1074613102 10:115039913-115039935 AACCTTGGTGTTCTATAATAGGG + Intergenic
1075034866 10:119056173-119056195 AACCATGCTTTTGTATCATTAGG + Intronic
1080025052 11:27604624-27604646 CACCTTGCTGTGTTCTCACATGG - Intergenic
1085280127 11:75324755-75324777 AACTTTTCTGTGGTCTCAGAAGG - Intronic
1098357472 12:69625204-69625226 TCCCTCGTTGTGGTATCATACGG + Intergenic
1098814276 12:75138040-75138062 ACCCATGCTGTGGTCTCACATGG + Intronic
1099576791 12:84392767-84392789 AACCTTGGTGTTCTATAATAGGG - Intergenic
1100092221 12:90985467-90985489 AACCTTGGTGTTCTATAATAGGG + Intronic
1101779740 12:107824575-107824597 AACCTTGGTGTTCTATAATAGGG + Intergenic
1105762559 13:23527692-23527714 AACCTTGGTGTTGTATAATAGGG + Intergenic
1107734923 13:43388949-43388971 CATCTGGCTGTGGTATCATCAGG + Intronic
1109654448 13:65370725-65370747 AACCTTTCTGGGGTTTTATATGG + Intergenic
1109939263 13:69338712-69338734 AACCTTGTTGTTCTAACATAGGG + Intergenic
1112333526 13:98495788-98495810 AATCTTGCTGTGAAATCACAAGG - Intronic
1112519193 13:100081131-100081153 AACCTTGGTGTTCTATAATAGGG + Intergenic
1118563408 14:67112481-67112503 AACCTTGGTGTGCTGCCATAGGG - Intronic
1120175351 14:81287951-81287973 CACCTTGCTGTGGTCTGATACGG + Intronic
1120198866 14:81515842-81515864 AACCTTGGTGTTCTATAATAGGG + Intronic
1124172231 15:27386448-27386470 AACATTGCTGTGATATCAGTGGG - Intronic
1126072003 15:44873560-44873582 AACCTTGGTGTTCTATCACAGGG - Intergenic
1126591063 15:50340138-50340160 CACCTTGCTGTGCCCTCATATGG - Intronic
1129445765 15:75616765-75616787 AACATGGCTGTGGTACCATAGGG - Intronic
1131850203 15:96534001-96534023 AACTTTGCTATGGTATGGTATGG - Intergenic
1131853951 15:96572210-96572232 AACCTAGCTGTTGTACAATATGG - Intergenic
1138036996 16:53617827-53617849 AACCATGCTGTTGTATCAGCAGG - Intronic
1139020764 16:62746148-62746170 AAACTTGCTCATGTATCATATGG + Intergenic
1141785241 16:86195289-86195311 AAGCTTGCTGTGGTGTCACTAGG + Intergenic
1150152041 17:62817930-62817952 CACCTTGTTGTGCTATCAGATGG - Intergenic
1152010731 17:77712279-77712301 ATTCTTGCTGTGGCATCATGTGG - Intergenic
1152027454 17:77821101-77821123 AGCATTTCTGTGATATCATAAGG - Intergenic
1157147534 18:45179612-45179634 AACCTTGCTGTGTTCTCCTTCGG - Intergenic
1157930073 18:51812095-51812117 ACCCTTGCTGGGGTTTCACATGG - Intergenic
1162237408 19:9320125-9320147 AACCTTGGTGTTCTATAATAGGG - Intergenic
1163049379 19:14670463-14670485 AACCTTGCTGGTCTCTCATAAGG - Intronic
925036186 2:688150-688172 CTCCTTGCTGTGCCATCATATGG + Intergenic
929330437 2:40675003-40675025 AACCTTGGTGTTCTATAATAGGG + Intergenic
930178398 2:48324562-48324584 AAACTTGATGTGGTATGATTTGG + Intronic
930348728 2:50221330-50221352 CAACTTGCTGTGGTAACACATGG - Intronic
930603017 2:53463710-53463732 AATGTTGCCATGGTATCATAAGG - Intergenic
932964008 2:76449123-76449145 CTCCTTGCTGTGATATCATATGG + Intergenic
934585060 2:95484633-95484655 AAGCTTGCTGTCGAATCAGATGG + Intergenic
936913450 2:117615762-117615784 AATCTTGCTGAGGTGTCCTAAGG - Intergenic
937165772 2:119815047-119815069 CACCTTGCTGTGGTTTCATCAGG + Intronic
940503964 2:154528557-154528579 AACCTTGTTGTTCTAACATAAGG - Intergenic
941537497 2:166741312-166741334 AACCTTGGTGTTCTATAATAGGG - Intergenic
941731496 2:168922776-168922798 TACTTTGCTGTAGTTTCATAAGG - Intergenic
944473275 2:200078385-200078407 AACGATGCTGTGGTATTAGATGG + Intergenic
945548618 2:211190356-211190378 AACCTTGCTTTGGTTTCTTGGGG + Intergenic
946794945 2:223340379-223340401 AGCCATGCTGTTGAATCATATGG - Intergenic
947485306 2:230542528-230542550 AACATTTCTGTACTATCATAAGG + Intronic
948997394 2:241589599-241589621 AACCTTGCTGGGGTGTCAAGGGG + Intronic
1169393979 20:5213703-5213725 AAACTTGCTGTGGCTTCCTAGGG - Intergenic
1170890674 20:20372892-20372914 ATCCTTGCTGTGGGATGGTAGGG - Intergenic
1174080413 20:47967401-47967423 AACCTTGCTGCATTGTCATAAGG + Intergenic
1177860991 21:26453870-26453892 AATCTTTGTGTAGTATCATATGG + Intergenic
1181377844 22:22474708-22474730 CACCTTGCTGTGGTTTCCTGGGG - Intergenic
1182839270 22:33373244-33373266 AACCTTGTTGTTCTAACATAGGG - Intronic
951020544 3:17777293-17777315 AACCTTGGTGTTCTATAATAGGG + Intronic
953451980 3:43013361-43013383 CCCCTTGCTGTGGTTTCACACGG - Intronic
953518287 3:43618228-43618250 TACCTTCCTGTGGAATCTTAAGG - Intronic
956842902 3:73156652-73156674 AACCTTGGTGTTCTATAATAGGG - Intergenic
957089203 3:75712356-75712378 AACCTTGTTGTTCTAACATAGGG + Intronic
957971492 3:87388436-87388458 CACCTTGCTGTGTCATCACATGG + Intergenic
958541025 3:95472559-95472581 AACCTTGTTGTTCTAACATAAGG + Intergenic
958601442 3:96300634-96300656 AACCTTGGTGTTCTATAATAGGG + Intergenic
962589743 3:136877591-136877613 CACCTTGCTGGGCTATCAAAGGG - Intronic
963696805 3:148573687-148573709 AACCTTGGTGTTCTATAATAGGG + Intergenic
964064552 3:152562677-152562699 AACCTTGGTGTTCTATAATAGGG + Intergenic
965701244 3:171460659-171460681 AACCTTGACTTGTTATCATAGGG + Intergenic
966091419 3:176143152-176143174 AACCTTGTTGTGGTATTTTCAGG + Intergenic
967583663 3:191188291-191188313 AACCTTGGTGTTCTATAATAGGG + Intergenic
969967617 4:11013292-11013314 TCCCTTGCTGTGGTATCAGATGG + Intergenic
971578522 4:28305867-28305889 AACCTTGGTGTTCTATAATAGGG + Intergenic
973045912 4:45534307-45534329 AACCTTGGTGTTCTATAATAGGG + Intergenic
974174549 4:58307209-58307231 AACCTTGGTGTTCTATCATAGGG + Intergenic
977834878 4:101635417-101635439 AACCTTGGTGTTCTATAATAGGG - Intronic
983336161 4:166395926-166395948 AACCATGCTGTGATATTAAAAGG - Intergenic
986598512 5:9448176-9448198 AACCTTTCTGAGCTATCCTATGG + Intronic
986933358 5:12854324-12854346 AACCTTGGTGTTCTATAATAGGG + Intergenic
988357844 5:30200465-30200487 AACCTTGGTGTTTTATAATAAGG + Intergenic
988536779 5:32075492-32075514 AACCTTGCTGTGGTATCATATGG + Intronic
988591969 5:32557003-32557025 AACCTTGGTGTTCTATAATAGGG - Intronic
989957394 5:50373196-50373218 AACCTTGGTGTTCTATAATAGGG + Intergenic
990367821 5:55088316-55088338 AACCTTGGTGTTCTATAATAGGG - Intergenic
992455244 5:76910357-76910379 AACCTTGGTGTTCTATAATAGGG + Intronic
993165274 5:84345914-84345936 AACATTGTTGTGTTTTCATAGGG - Intronic
994337152 5:98580535-98580557 AAACTTGATGTGGCATTATAGGG + Intergenic
998133596 5:139663263-139663285 AGCCTTGCTGTGTGAGCATAGGG - Intronic
998915111 5:147004011-147004033 AACCTTGGTGTTTTATAATAGGG + Intronic
1003805825 6:9725159-9725181 AACCTTGGTGTTCTATAATAGGG + Intronic
1005847996 6:29797361-29797383 AAGCTGGCTGTTGTGTCATAAGG + Intergenic
1009528400 6:64777584-64777606 AACTTTGCTGTGATCTCATTAGG - Intronic
1010074988 6:71788417-71788439 AACCTTGGTGTTCTATAATAGGG + Intergenic
1010114918 6:72292882-72292904 AACCTTTCAGTTGTTTCATAGGG - Intronic
1010641914 6:78339643-78339665 AAACTTGCTGTGGTATTGTAGGG - Intergenic
1010690113 6:78900754-78900776 AACCTTGCAGTGTTATTATAAGG + Exonic
1011415173 6:87111304-87111326 AACCTTGTTGTTCTAACATAGGG - Intergenic
1012441518 6:99265951-99265973 AACCTTGGTGTTCTATAATAGGG - Intergenic
1012873844 6:104702344-104702366 AAGCTTCCTGTGGGATCAAAAGG + Intergenic
1016285693 6:142470083-142470105 AACCATGCCATGGTATGATATGG - Intergenic
1021356549 7:19658180-19658202 AACCTTGGTGTTCTATAATACGG - Intergenic
1021756693 7:23859236-23859258 AACCTTGGTGTTCTATAATAGGG - Intergenic
1028495192 7:91453463-91453485 AACCTTGGTGTTCTATAATAGGG - Intergenic
1031822836 7:126526011-126526033 AATCTAAATGTGGTATCATATGG - Intronic
1033759216 7:144422062-144422084 AACCTTGGTGTTCTATAATAGGG - Intergenic
1034579946 7:152033419-152033441 AACCTTGGTGTTCTATAATAGGG - Intronic
1038638819 8:29307842-29307864 AACCTTGGTGTTCTATAATAGGG + Intergenic
1038914672 8:32007469-32007491 AACCTTGCTATGGTATTTTATGG - Intronic
1039276039 8:35934867-35934889 AACCTTGGTGTTCTATAATAGGG + Intergenic
1040953427 8:52957513-52957535 AACCTTGGTGTTCTATAATAGGG + Intergenic
1041546824 8:59055172-59055194 AAGCTTGCTGTGATATCAAAGGG + Intronic
1043126153 8:76398372-76398394 AACCCTACTGTGGTGTCATGAGG - Intergenic
1044005403 8:86931655-86931677 AACCTTGGTGTTCTATAATAGGG - Intronic
1044271344 8:90247910-90247932 AATCTGGCTTTGGTATAATAAGG - Intergenic
1049136846 8:140909891-140909913 AACCTTACTATGGTAACATCTGG + Intronic
1050266657 9:3897852-3897874 AACCTGGCTCTGGAATCAGATGG + Intronic
1051935304 9:22437405-22437427 AACCTTGGTGTTCTATAATACGG + Intergenic
1052289521 9:26826218-26826240 AACCTTGGTGTTCTATAATAGGG + Intergenic
1055050705 9:71977312-71977334 AAACTTGCTGAGGTATCAGCTGG - Intronic
1055748670 9:79479497-79479519 AACCCTGCAGTGGAATCCTAGGG - Intergenic
1057532463 9:95863831-95863853 AACCTTTCTGAGGTTTTATACGG + Intergenic
1203488385 Un_GL000224v1:79598-79620 AACCTTGTTGTTCTAACATAGGG - Intergenic
1203501006 Un_KI270741v1:21494-21516 AACCTTGTTGTTCTAACATAGGG - Intergenic
1188097552 X:26042976-26042998 AACCTTGGTGTTCTATAATAGGG + Intergenic
1190541493 X:51482481-51482503 AACCTTGGTGTTCTATAATAGGG + Intergenic
1192482731 X:71499331-71499353 AACCTTGGTGTTCTATAATAGGG - Intronic
1194056585 X:89142289-89142311 AACATTGCTGTGATATTATGAGG - Intergenic
1194111942 X:89844832-89844854 AACCTGCCTGCGGTGTCATATGG + Intergenic
1199370012 X:147036313-147036335 TACCTTGTTCTGCTATCATATGG + Intergenic
1199441522 X:147873844-147873866 CACCTTGTTGTGGGATCAAATGG - Intergenic
1200711299 Y:6487155-6487177 AACCTTGGTGTTCTATTATAGGG + Intergenic
1200800999 Y:7387029-7387051 AACCTTGGTATTGTATAATAGGG - Intergenic
1201022635 Y:9674831-9674853 AACCTTGGTGTTCTATTATAGGG - Intergenic
1201312028 Y:12605858-12605880 AACCTTGGTGTTCTATAATAGGG - Intergenic
1201429719 Y:13891811-13891833 AACCTTGGTGTTCTATAATAGGG + Intergenic
1201473144 Y:14355073-14355095 AACCTTGGTGTTCTATAATAGGG - Intergenic
1201568561 Y:15390964-15390986 AACCTTGGTGTTTTATAATAGGG - Intergenic
1201989489 Y:20008624-20008646 AACCTTGGTGTTCTATAATAGGG - Intergenic
1202089852 Y:21178159-21178181 AACCTTGGTGTTTTATAATAGGG - Intergenic
1202257851 Y:22939870-22939892 AACCTTGGTGTTCTATAATAGGG + Intergenic
1202410841 Y:24573617-24573639 AACCTTGGTGTTCTATAATAGGG + Intergenic
1202459940 Y:25096455-25096477 AACCTTGGTGTTCTATAATAGGG - Intergenic