ID: 988538300

View in Genome Browser
Species Human (GRCh38)
Location 5:32087878-32087900
Sequence GGGGCCAGACCTCCTCCCCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 205}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988538287_988538300 26 Left 988538287 5:32087829-32087851 CCAGCCGGGGCTGGAGGTGGGAG 0: 1
1: 1
2: 6
3: 69
4: 732
Right 988538300 5:32087878-32087900 GGGGCCAGACCTCCTCCCCGAGG 0: 1
1: 0
2: 0
3: 27
4: 205
988538296_988538300 -8 Left 988538296 5:32087863-32087885 CCGAACCAGTCCCGGGGGGCCAG 0: 1
1: 0
2: 1
3: 12
4: 101
Right 988538300 5:32087878-32087900 GGGGCCAGACCTCCTCCCCGAGG 0: 1
1: 0
2: 0
3: 27
4: 205
988538283_988538300 30 Left 988538283 5:32087825-32087847 CCCACCAGCCGGGGCTGGAGGTG 0: 1
1: 0
2: 2
3: 31
4: 443
Right 988538300 5:32087878-32087900 GGGGCCAGACCTCCTCCCCGAGG 0: 1
1: 0
2: 0
3: 27
4: 205
988538293_988538300 -3 Left 988538293 5:32087858-32087880 CCGTGCCGAACCAGTCCCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 49
Right 988538300 5:32087878-32087900 GGGGCCAGACCTCCTCCCCGAGG 0: 1
1: 0
2: 0
3: 27
4: 205
988538289_988538300 1 Left 988538289 5:32087854-32087876 CCTGCCGTGCCGAACCAGTCCCG 0: 1
1: 0
2: 0
3: 1
4: 44
Right 988538300 5:32087878-32087900 GGGGCCAGACCTCCTCCCCGAGG 0: 1
1: 0
2: 0
3: 27
4: 205
988538284_988538300 29 Left 988538284 5:32087826-32087848 CCACCAGCCGGGGCTGGAGGTGG 0: 1
1: 0
2: 3
3: 54
4: 459
Right 988538300 5:32087878-32087900 GGGGCCAGACCTCCTCCCCGAGG 0: 1
1: 0
2: 0
3: 27
4: 205
988538288_988538300 22 Left 988538288 5:32087833-32087855 CCGGGGCTGGAGGTGGGAGCTCC 0: 1
1: 1
2: 20
3: 144
4: 748
Right 988538300 5:32087878-32087900 GGGGCCAGACCTCCTCCCCGAGG 0: 1
1: 0
2: 0
3: 27
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988538300 Original CRISPR GGGGCCAGACCTCCTCCCCG AGG Exonic
900577878 1:3393302-3393324 GCGGCCAGTCGTCCTCCCTGAGG + Intronic
902600806 1:17539473-17539495 GGGGCCGGGCCCCATCCCCGCGG + Intergenic
903438145 1:23368120-23368142 GGGGCCAGAACTCCAGCCCTGGG - Intronic
904171307 1:28593609-28593631 GAGGCAGGACCTCCTCCCCCTGG - Intronic
904201464 1:28822365-28822387 AGGGCCAAACCTCCACCCAGTGG - Intronic
904237125 1:29123098-29123120 GGAGCAAGGCCGCCTCCCCGAGG - Intronic
904343496 1:29853187-29853209 GGGGCCAGCCAGCCTCCCCCGGG + Intergenic
904383630 1:30127694-30127716 GGGGCCACATCTCCTGCCAGGGG - Intergenic
905890024 1:41513081-41513103 GGGGCCAGTTCTCTTCCCAGGGG + Exonic
905897894 1:41560625-41560647 GGGGCCAGGACTTCACCCCGTGG + Intronic
910773337 1:90851404-90851426 GGGGTCTCACCTCCTGCCCGAGG - Intergenic
912435314 1:109657154-109657176 GAGCCCAGCCCTCCTTCCCGGGG - Intronic
912439714 1:109688612-109688634 GAGCCCAGCCCTCCTTCCCGGGG - Intronic
912443026 1:109713061-109713083 GAGCCCAGCCCTCCTTCCCGGGG - Intronic
915121893 1:153634464-153634486 GGGGCTCCGCCTCCTCCCCGGGG - Intronic
915701606 1:157802036-157802058 GGGGGCCGACCTGCTCCCCAGGG + Exonic
916717002 1:167455021-167455043 GGGGCCAGGCCTCCGCCCCTCGG + Intronic
918867015 1:189914619-189914641 GGGGACAGACCTACTCCTCCTGG - Intergenic
920295577 1:204954244-204954266 GGTCCCAGACCTCCTCCTCATGG - Exonic
921355440 1:214281058-214281080 CGGGCCCGTCCCCCTCCCCGCGG + Intergenic
923141239 1:231162739-231162761 GGGTCCTCACCTCCTGCCCGAGG - Intronic
1062797719 10:357282-357304 GGGGCCAGGCCTCCTAACAGTGG - Intronic
1064137533 10:12763925-12763947 TGGGCCAGACCCTCTCCCTGTGG + Intronic
1066335078 10:34468099-34468121 GGGGCCTGAACTCCTCCCACCGG - Intronic
1066464530 10:35640849-35640871 GGGGCCAGGCCCCCGCACCGCGG - Exonic
1069771888 10:70905543-70905565 GGGGCCAGAGCTCCCACCCGGGG - Intergenic
1070606243 10:77900463-77900485 GGAGACAGACCTTCACCCCGGGG + Intronic
1070792368 10:79196989-79197011 GGGGCCAGACCTGCACACTGTGG - Intronic
1071579723 10:86757373-86757395 GGGGCCAGGGCCCCTTCCCGCGG - Intronic
1073105965 10:101032204-101032226 GGGGCCAGAACTGATCCCCGAGG + Intronic
1074219233 10:111420131-111420153 GTGGCCAGACCTCCTGGCTGAGG + Intergenic
1074369303 10:112886671-112886693 GGGGCCAGGCCTTCTTCCTGGGG - Intergenic
1076857265 10:133123562-133123584 GGGGCCGCACCGCCTTCCCGTGG + Intronic
1077017601 11:403851-403873 GGGGCCAGTCCAGCTCCCTGGGG + Intronic
1077096763 11:802260-802282 GGAGCCAGGCCTCGTCCCCCTGG - Exonic
1077135743 11:997418-997440 GGAGCCAGGCCTGCTCCCTGAGG + Intronic
1081976722 11:47240065-47240087 GGGCCCAGCCCACCTCCCCTAGG + Exonic
1083033583 11:59615790-59615812 CGGCCGAGCCCTCCTCCCCGCGG - Exonic
1083157954 11:60836948-60836970 GGGGCCAGACCTGCTACCCCAGG - Intergenic
1083298329 11:61727138-61727160 GGGACCAGACCTGCCCCCTGAGG - Intronic
1083487604 11:62993366-62993388 GGGCCCAGACCTGCTTCCCCAGG + Intronic
1083618198 11:64036489-64036511 CGGGCCAGGCCCCCTCCCTGGGG - Intronic
1083682977 11:64359691-64359713 GGCGCCAGTCCCCCTCCCCAGGG - Intronic
1084225359 11:67711774-67711796 GGGGCCAGGCCTGGGCCCCGCGG + Intergenic
1084575197 11:69984665-69984687 GAGGACAGACCACATCCCCGCGG - Intergenic
1084810222 11:71607500-71607522 GGGACCAGGCCTGGTCCCCGCGG - Intergenic
1084960391 11:72713278-72713300 GGGGCCTGGCCTCCTCTCCTGGG + Intronic
1086561633 11:88175510-88175532 GGGGGCGGAACTCCTCCCCTAGG + Intergenic
1088558044 11:111082881-111082903 GGAGTCAGACCACCTCCACGTGG - Intergenic
1089215140 11:116830492-116830514 GGGGCCACGCCACCTCCCCAGGG + Intronic
1089497916 11:118916991-118917013 AGGGCCAGCCCTCCTCCCTGAGG - Intronic
1089527645 11:119107646-119107668 GGGAGCCCACCTCCTCCCCGCGG + Exonic
1091218975 11:133919593-133919615 GCGGCCAGAACTCCTCTCCGAGG + Intronic
1092239864 12:6829795-6829817 GGGGGCAGACCTCTGCCCCCTGG - Intronic
1097984862 12:65772285-65772307 AGGGACAGACCTCTTCTCCGGGG - Intergenic
1101873078 12:108581538-108581560 AGGGCCGGACCTCCACCCTGGGG + Intergenic
1102423853 12:112825079-112825101 GGGGCCAGAGGTCCTCCAGGTGG + Intronic
1103393164 12:120588919-120588941 GGGTCCAGTCCTCCCCCCAGGGG + Intergenic
1103742936 12:123103598-123103620 GGGGCCAGCCCTTCTTCCCTTGG + Intronic
1104733580 12:131122400-131122422 GGGGCCGCAGCGCCTCCCCGGGG + Intronic
1104900977 12:132189405-132189427 GGGGGAAGAACACCTCCCCGAGG - Intergenic
1105431270 13:20339760-20339782 GAGCCCAGACTTCCTCCCTGAGG + Intergenic
1105814045 13:24017066-24017088 GGGGGCAGACATCCTTCCCATGG + Intronic
1110800161 13:79684905-79684927 GGGCCCAGACCTGCTCCCTGGGG + Intergenic
1113711249 13:112466838-112466860 GTGCCCAGGCCTCCTCCCCCAGG + Intergenic
1113730405 13:112637377-112637399 GCGCCCACTCCTCCTCCCCGCGG - Intergenic
1116671325 14:47846304-47846326 GCAGCCAGCCCTCCTCCCAGGGG - Intergenic
1117274635 14:54180238-54180260 GCTGCCAGACCCCATCCCCGTGG - Intergenic
1118904742 14:70015619-70015641 GGGGCCAGGCCTCCTCCAGGAGG + Intronic
1121020150 14:90575082-90575104 GGGGCCCTGCCTCCTCCCTGGGG + Intronic
1122231251 14:100307153-100307175 CGGGCCACAGCTCCTTCCCGAGG + Intergenic
1122776497 14:104119214-104119236 TGGGCCAGACCCCCTCCCTCGGG + Intergenic
1122970916 14:105151867-105151889 GGGGCCTGACCGGCTCCCCAGGG + Intronic
1123183198 14:106489188-106489210 GGGGTCAGGGCTCCTCCCCAGGG - Intergenic
1124249353 15:28096953-28096975 GGGGCCAGGACCCCTCCCCGCGG + Intronic
1125602529 15:40923437-40923459 CGGGCCAGGCCTCCCACCCGGGG + Intergenic
1129608187 15:77034983-77035005 CGAGCCAGCCCTCCTCCCTGTGG - Intronic
1129690121 15:77708417-77708439 GGGCCCAGACTTCCACCCTGTGG - Intronic
1131258877 15:90878256-90878278 TGGGCCAGCCCGCCTCGCCGAGG + Exonic
1131317832 15:91356094-91356116 GAGGACAAACCTCCTCACCGTGG + Intergenic
1132206071 15:99987051-99987073 GGGGCCTGCCCACCTCCCCAAGG + Intronic
1132685269 16:1159453-1159475 GCGCCCAGACCTCCTCCCCACGG - Intronic
1132687347 16:1167936-1167958 GGAGCCAGGCCTGTTCCCCGGGG + Intronic
1132699150 16:1214913-1214935 GGGGCCACCCCTCTTCCCCCTGG - Intronic
1132903774 16:2271925-2271947 GGGGCAAGGCCTCCTCCAGGAGG - Intergenic
1133264516 16:4575332-4575354 GGTCCCAGAGCTCCTCCCGGAGG + Exonic
1135773567 16:25236227-25236249 GGCGCCAGACCTCCTGACAGAGG + Exonic
1136383984 16:29911404-29911426 GGAGCCAGGCCACCTCCCCGGGG + Intronic
1136569917 16:31090608-31090630 GGAGCCAGGCCTCCTCTCCTGGG - Intronic
1137568545 16:49549562-49549584 GGGACCACACCTCCTTCCCTAGG + Intronic
1138586347 16:57972758-57972780 GGGGTCAGAGCTCCTCCCCAAGG + Intergenic
1139393616 16:66622248-66622270 GGGGCCAGGCCACGTGCCCGAGG - Intronic
1140415278 16:74770018-74770040 GGGTCCAGGCCTTCTCCCTGGGG + Intronic
1141425028 16:83939347-83939369 AGGGCCGGGCCTCCTCCTCGTGG + Intronic
1141995507 16:87634446-87634468 GCGGCCAGGCCTCCACCCTGAGG - Intronic
1142132641 16:88437932-88437954 GAGGACAGGCCTCCTCCCCGGGG + Exonic
1142188472 16:88706127-88706149 GGGGCACGGCCCCCTCCCCGCGG + Intronic
1142393162 16:89816100-89816122 GGGGCCGGGGCTCCTCCCCAGGG + Intronic
1142856148 17:2731470-2731492 CGGTTCACACCTCCTCCCCGTGG - Intergenic
1143401852 17:6651432-6651454 TGACCCAGACCTCTTCCCCGTGG - Intronic
1143594460 17:7906187-7906209 GGGGCCAGGCATCCTCCCCAGGG + Intronic
1144825820 17:18105173-18105195 GAGCCCAGACCACCTCCCCTGGG - Intronic
1146922221 17:36721384-36721406 AGGGCCAGACCCCCACCCCTGGG + Intergenic
1147224674 17:38967455-38967477 GGGGGCGGGCCTCCTTCCCGCGG - Intergenic
1148478848 17:47946740-47946762 AGAGCCAGTCTTCCTCCCCGCGG - Exonic
1152190206 17:78883561-78883583 GGGGCCACACCGCCTGCCAGCGG + Intronic
1152381785 17:79945952-79945974 GCGGCCAGCCCTCCGCCCTGTGG + Intronic
1152587984 17:81197583-81197605 GGCGAGAGACCTCCTCCCCCTGG + Intronic
1152668059 17:81582959-81582981 AGGGCCAGGCCTCCTCCCTGCGG + Intronic
1156185666 18:34660294-34660316 GGGGTCAGACATCCTCCCTTTGG + Intronic
1157320297 18:46629069-46629091 AGGGCCAGCCCTCCTCCATGGGG - Intronic
1160503498 18:79414165-79414187 GAGGCCAGACTTCCTTCCCCAGG + Intronic
1160964767 19:1742370-1742392 GGGTCGCAACCTCCTCCCCGGGG + Intergenic
1161776294 19:6263977-6263999 GGGGCCTGAGCTTCTCCCTGGGG + Intronic
1162799328 19:13102399-13102421 GGGGCCAGGCCTGCTTCCCCAGG - Intronic
1163645249 19:18485546-18485568 GGGGCCAGACCTGGTCTCCCTGG - Intronic
1163714523 19:18866173-18866195 GGGGCCAGGCCTGCTCCAGGGGG - Intronic
1164938225 19:32231226-32231248 GGGGCAGGATCTCATCCCCGTGG - Intergenic
1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG + Intronic
1165862917 19:38918530-38918552 GTGGCCTGGCCTCCTCCCCCAGG - Exonic
1166880615 19:45927748-45927770 GGCGCCACACCTCCTCCACGTGG - Intergenic
1167371568 19:49085700-49085722 GGGCCCGGTCCTCTTCCCCGCGG + Intronic
1167471319 19:49677721-49677743 GCCCCCAGCCCTCCTCCCCGGGG + Intronic
1168146385 19:54421790-54421812 GGGGCCAGGCCTCAGCCCCAGGG - Intronic
926231186 2:11005422-11005444 GGGGCCAGGCCTCATCTCAGGGG - Intergenic
927714348 2:25342275-25342297 GGGTCCAGACCTCCGCCAAGCGG - Intronic
927857743 2:26537830-26537852 GGGGTCAGACCTCCTCATCCTGG + Intronic
929922485 2:46182442-46182464 GGGGCCAGCCCTCCTGGCAGAGG + Intronic
936550748 2:113437659-113437681 GGGGAGAGCCCACCTCCCCGGGG + Intergenic
937853415 2:126656101-126656123 CGGGCCAGAGCCCCTCCCCTCGG + Exonic
941122487 2:161546844-161546866 GGGGCCAGATTTCCCCCCCTTGG - Intronic
941646601 2:168047702-168047724 GAGACCAAACCTCCTCCCCAGGG + Intronic
946420586 2:219562375-219562397 GGGCCCAGCCCAGCTCCCCGGGG - Intronic
947617766 2:231569251-231569273 GGAGCCAGCTCTCCTCCCCTGGG - Intergenic
947770896 2:232669191-232669213 GGGGCCTGGCCTCCTCCAAGGGG + Intronic
948492326 2:238321114-238321136 GGGGCAGGACCTCCTCACGGAGG - Intronic
1174398187 20:50260818-50260840 GGGGCCTGGCCTCCTCCAAGGGG + Intergenic
1174453766 20:50635869-50635891 GGAGCCAGACCTCCTCCAGCGGG + Intronic
1175954964 20:62604552-62604574 TGGCCCAGGCCTCCTCCCCAAGG + Intergenic
1175999658 20:62826151-62826173 GGGGCTGCACCTCCACCCCGGGG - Intronic
1176008513 20:62879817-62879839 GCGGCCCGGCCTCCTCCCAGCGG + Exonic
1178608208 21:34057547-34057569 GGAACCAGACCCCCTCCCTGGGG + Intergenic
1178887096 21:36493133-36493155 GAGGCTCGACCTCCTCCCCGGGG - Intronic
1180018205 21:45101205-45101227 GGCGGCACACCTGCTCCCCGAGG - Intronic
1180258980 21:46653584-46653606 GGGGCCAGAAGTCCTCCCTTAGG - Intronic
1183506981 22:38214811-38214833 GGGGCCAGACCCCGAGCCCGGGG - Exonic
1183688475 22:39375319-39375341 GGGCCCAGCCCACCTCCCAGAGG - Intronic
1183986142 22:41571758-41571780 GGGACCAGCCCTCCTCACTGTGG + Intronic
1184152918 22:42649056-42649078 GGACCCAGCCCTCCTGCCCGGGG - Intronic
1184717956 22:46292637-46292659 GAGGCCAGGCCTCCTGCCCCTGG + Intronic
1185112440 22:48908124-48908146 GAGGCCTAACCCCCTCCCCGTGG - Intergenic
1185226609 22:49657085-49657107 TGGCCCCGACCTCCTCCCCCAGG - Exonic
1185246289 22:49775013-49775035 GGGGCCACAGCTCCTCCCAGAGG + Intronic
1185268517 22:49917931-49917953 GGGGCCGGACCTCCCACCTGGGG - Intronic
1185268555 22:49918028-49918050 GGGGCCAGACCTCTCACCCGGGG - Intronic
950316181 3:12004154-12004176 GGAGCCAGGCCTTCTCCCCAGGG - Intergenic
950453869 3:13080825-13080847 AGGCCCTGCCCTCCTCCCCGGGG + Intergenic
954145089 3:48630538-48630560 GGGGAGAGACCTCCTTCCCCAGG + Intronic
954146592 3:48637466-48637488 GAGGCCCGAGCCCCTCCCCGTGG + Exonic
954464421 3:50646172-50646194 CGGGCCAGGCCATCTCCCCGGGG + Exonic
955059541 3:55483637-55483659 GCCCCCAGTCCTCCTCCCCGTGG - Intronic
956813643 3:72888398-72888420 GGGGCCGGGCGCCCTCCCCGGGG + Exonic
961611594 3:128144014-128144036 GTGGCAAGAACTCCTCCACGCGG - Intronic
968486577 4:865907-865929 GGCGCCTGACCTCCTCCCCATGG + Intronic
968804658 4:2764276-2764298 GGGTCCACACCGCCTCCTCGTGG - Intergenic
969114118 4:4860542-4860564 GGTTCCAGACCTCCTCGCCTTGG + Intronic
969732170 4:8963884-8963906 GGGGCCAGGCCTGGGCCCCGCGG - Intergenic
972765693 4:42151340-42151362 GGGGCCAGACGCCCCCCCGGGGG - Intronic
986573580 5:9190250-9190272 GGGGCCAGAGCTCCTACCTGTGG + Exonic
987193158 5:15500081-15500103 CGGGCCGGCCTTCCTCCCCGGGG + Intergenic
987368899 5:17175227-17175249 GTGGCCAGAACACCTCCCTGTGG + Intronic
988538300 5:32087878-32087900 GGGGCCAGACCTCCTCCCCGAGG + Exonic
999328244 5:150656672-150656694 GGCGCAAGAGCGCCTCCCCGCGG + Intronic
1000922968 5:167160305-167160327 GCGGCCAGACCTCCGTCCTGTGG - Intergenic
1001494745 5:172179751-172179773 GGGGCCAGATCTCTTTCCGGAGG + Intronic
1001960458 5:175877516-175877538 GAGGCCAGGCCTGCTCCCCAAGG - Intronic
1002181360 5:177432705-177432727 GGGTCCTGACCTCATCCCTGAGG + Exonic
1002198575 5:177514208-177514230 TGGGCCAGACCCCATCCCGGAGG - Intronic
1002640769 5:180629601-180629623 GGGCCCACACATCCTCCACGCGG + Intronic
1003126974 6:3363388-3363410 GGGCCCAGGCTTCCTCCTCGGGG + Intronic
1006181916 6:32158798-32158820 GGTGCCAGACCTTCTCCCTGGGG - Intronic
1006502237 6:34466265-34466287 AGGGCCAGACCTCCTACCTGGGG - Exonic
1007421892 6:41724596-41724618 GGAGCCAGAGGTCCTCCCTGGGG - Intronic
1007682605 6:43644958-43644980 CCGCCCAGACCTCCTCCCCACGG - Intergenic
1007760192 6:44128591-44128613 GCGGCCAGACCTCTGCCCAGGGG - Intronic
1013406530 6:109848771-109848793 GGGGCCTGAACACCTCCACGAGG - Intergenic
1019373609 7:676869-676891 GGGGCCTGCCCACCTCCCGGAGG + Intronic
1019373630 7:676927-676949 GGGGCCTGCCCACCTCCCGGAGG + Intronic
1019373651 7:676985-677007 GGGGCCTGCCCACCTCCCGGAGG + Intronic
1019373671 7:677043-677065 GGGGCCTGCCCACCTCCCGGAGG + Intronic
1019636593 7:2079193-2079215 GGGGCAAGCCCTCCTCCCTGGGG + Intronic
1020112164 7:5453451-5453473 CGGGCCGGCCCTCCTCCCCTGGG + Intronic
1020309113 7:6855561-6855583 GGGGCCAGGCCTGGGCCCCGGGG + Intergenic
1023038505 7:36153189-36153211 GCGGCCACGCCTCCTCCGCGCGG - Exonic
1026878811 7:73895089-73895111 GGGGCCAGCCCCCCTCCCTGGGG - Intergenic
1031920069 7:127593801-127593823 TGGCCCAGCCCTCCCCCCCGTGG - Exonic
1032238277 7:130142295-130142317 GGGGTCAGCCTTCCTCCCAGGGG - Intergenic
1034897779 7:154888506-154888528 GAGGCCAGAGCTCCTGGCCGAGG + Intronic
1035203901 7:157282346-157282368 GTGGCCAGGCCACCTCCCTGTGG - Intergenic
1035455333 7:159005310-159005332 GGGGGCAGATGTCCTCTCCGAGG - Intergenic
1041059383 8:54021905-54021927 GGGCCCGGACACCCTCCCCGGGG + Intronic
1049342717 8:142121850-142121872 GGGGCCGGTCCTGCTGCCCGTGG - Intergenic
1049434273 8:142579295-142579317 GGGGCCAGAGCTCGACTCCGAGG + Intergenic
1049444827 8:142625052-142625074 GGAGCCTGACCTCCACCCTGAGG - Intergenic
1049518022 8:143072463-143072485 GGAGACAGCCGTCCTCCCCGGGG + Intergenic
1049769656 8:144373979-144374001 GGAGCCAGAGCCCCGCCCCGTGG - Intronic
1049801618 8:144520382-144520404 TGGGCCAGCCCCCATCCCCGTGG + Exonic
1049902186 9:179157-179179 GGGGAGAGCCCACCTCCCCGGGG - Intergenic
1053280680 9:36818278-36818300 TGGGCCAGCCTCCCTCCCCGGGG - Intergenic
1053509031 9:38671558-38671580 GGGCCCTCACCTCCTCCACGTGG + Intergenic
1053745216 9:41189446-41189468 GGGGAGAGCCCACCTCCCCGGGG - Intronic
1054482056 9:65675767-65675789 GGGGAGAGCCCACCTCCCCGGGG + Intronic
1054683131 9:68241822-68241844 GGGGAGAGCCCACCTCCCCGGGG + Exonic
1054959751 9:70954789-70954811 AGGGCCCGGCCTTCTCCCCGAGG - Intronic
1055030495 9:71768440-71768462 GGGTCCAGATCTCCTCTCCATGG + Exonic
1056454979 9:86751463-86751485 TGGGCCAGACCTCCACCCCCAGG + Intergenic
1056568523 9:87796111-87796133 GGAGCCACTCCTCCTCCCCATGG - Intergenic
1061519859 9:131111695-131111717 GGGGCCAGCCCACCTCCCCCAGG - Intronic
1061993847 9:134174212-134174234 GGGGCCAGACATCATGCACGTGG - Intergenic
1062085454 9:134645813-134645835 GGGCCCTGGCCTTCTCCCCGGGG - Intronic
1062194735 9:135266719-135266741 GGGAGCAGACGTCCTCCCAGGGG - Intergenic
1062207884 9:135347239-135347261 GTGCCCAGAACTCCTCCCCCAGG + Intergenic
1062343837 9:136105668-136105690 GGGAGCCGACCTCCTCCCCAGGG - Intergenic
1062577257 9:137214513-137214535 GGGCCCCGACATCCTCCCTGCGG + Intronic
1202781344 9_KI270718v1_random:230-252 GGGGAGAGCCCACCTCCCCGGGG - Intergenic
1185465546 X:352391-352413 GCCCCCAGGCCTCCTCCCCGTGG + Intronic
1186198099 X:7130101-7130123 GGGCCCAGTCCTCCTTCCTGGGG - Intronic
1190160228 X:48026857-48026879 GGCGCCAGTCCTCTTCTCCGGGG - Intronic
1192638848 X:72844986-72845008 GGGGCCAGACCTCCTCTAAATGG + Intronic
1192642864 X:72875822-72875844 GGGGCCAGACCTCCTCTAAATGG - Exonic
1193410875 X:81161277-81161299 TGGGCCAGAACTCCTACCTGTGG - Intronic
1198404144 X:136295773-136295795 GGGGGCACACCTCCTCCACCAGG + Intergenic
1200093676 X:153647475-153647497 GGGGCCAGACCACCTCTGAGAGG + Intronic