ID: 988540798

View in Genome Browser
Species Human (GRCh38)
Location 5:32107259-32107281
Sequence CTGTAAGTAAGTAGTCCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 73}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988540798 Original CRISPR CTGTAAGTAAGTAGTCCCCA TGG Intronic
902262113 1:15234098-15234120 TTTTAAGTAAGTAGTCCCAAAGG + Intergenic
902859055 1:19231563-19231585 CTGTAGGTGAATAGTCCCCTAGG + Intronic
906870671 1:49476921-49476943 CTGGCAGTAAGTACTCCCTAAGG + Intronic
916315959 1:163447756-163447778 CAGTAGTTAAGTAGTCCCAATGG - Intergenic
918448162 1:184634671-184634693 GGGTAAGTAAGAAGACCCCAGGG + Intergenic
924310783 1:242741196-242741218 CTGCAAGGAAGTTGTCACCAGGG + Intergenic
1063144578 10:3285022-3285044 CTGTAAGTAGCCAGTCCTCAGGG + Intergenic
1070989565 10:80719469-80719491 CTGTAAGGATGCAGTGCCCAGGG + Intergenic
1074344287 10:112667122-112667144 ATGTTAGTAAGAAGTCACCATGG - Intronic
1076160590 10:128241374-128241396 CTGTCAGTACGAAGTCACCAGGG + Intergenic
1078493031 11:11786897-11786919 CTGCAAGTAACTAGTCTCCTAGG - Intergenic
1079870475 11:25792617-25792639 GTCTAAGTGAGTGGTCCCCATGG - Intergenic
1080208659 11:29759343-29759365 TTATAAGTATGTGGTCCCCATGG + Intergenic
1089832154 11:121338271-121338293 CTGTAACTGAGGCGTCCCCAGGG - Intergenic
1090608682 11:128451254-128451276 CTGTAAGGCAGGAGTCTCCAAGG - Intergenic
1091692924 12:2609361-2609383 CTGTGAATAAGGAGTGCCCACGG + Intronic
1091774506 12:3175618-3175640 CTCTAAGTGAGCAGGCCCCAGGG + Intronic
1093743315 12:22712668-22712690 CTGTAAGCTAGTAGTCCCCAAGG + Intergenic
1095160780 12:38912438-38912460 TTTTAAGTAGGTAGTCCCCAAGG - Intergenic
1098969578 12:76837088-76837110 CTGTTAGTAAGAAAACCCCATGG - Intronic
1105535039 13:21258128-21258150 CTGAAAATAAGTAATCACCATGG - Intergenic
1113069838 13:106409819-106409841 CTGTAATTAAGAAGAGCCCATGG + Intergenic
1118210684 14:63763317-63763339 CTGTAAAGAAGTAATGCCCATGG + Intergenic
1124964707 15:34424234-34424256 CTGTAGCTCAGCAGTCCCCAGGG - Intronic
1124981323 15:34570460-34570482 CTGTAGCTCAGCAGTCCCCAGGG - Intronic
1125282484 15:38057532-38057554 CTGTAAGTCAGAAGTCCAGAGGG + Intergenic
1128930546 15:71701208-71701230 ATGTATGTAAGTAATTCCCAGGG + Intronic
1140719359 16:77757323-77757345 CTGTAAGTATTTAGACCTCAGGG + Intergenic
1149725395 17:58888226-58888248 CTGTAAGTAAATGGTATCCATGG + Intronic
1154072980 18:11171218-11171240 ATGTAAATTAGTAGTTCCCAGGG + Intergenic
1155827167 18:30461062-30461084 CTATAAGAAAGCAGTCCACAAGG - Intergenic
1156617563 18:38805588-38805610 CTGTAAGTAGATAGTCCTTAAGG + Intergenic
928705792 2:33948222-33948244 CTGTATGTAAGTAATCCCTCAGG - Intergenic
933818214 2:86086030-86086052 CTGTGCCTGAGTAGTCCCCATGG - Intronic
946047188 2:216830944-216830966 TTGTAAGTAACTCCTCCCCAGGG - Intergenic
946646548 2:221843546-221843568 CTGTAAGTCAGAAGTCCAGAAGG + Intergenic
1169341246 20:4797993-4798015 CGGGAGGTAAGGAGTCCCCAGGG - Exonic
1170120492 20:12906551-12906573 CTGTAAGTAATTAGTCAACCTGG + Intergenic
1171005235 20:21458205-21458227 CTGTAAAGTAGTAGTCCTCAAGG + Intergenic
1172796680 20:37544532-37544554 CTGCTAGTCTGTAGTCCCCATGG - Intergenic
949354635 3:3165937-3165959 CTGTCAGTATGTGGCCCCCAAGG - Intronic
951317404 3:21204021-21204043 GGGTAAGTAAGCAGCCCCCAGGG - Intergenic
955699539 3:61670339-61670361 CTGCCAGTAACTAGTTCCCAGGG + Intronic
956992917 3:74789341-74789363 CTGTATGTGAGTCATCCCCACGG - Intergenic
957568216 3:81911500-81911522 CTGGAAGTCAGAAGTCCCAAAGG + Intergenic
958610658 3:96421002-96421024 TTGTAAGTAAGTAATCACAAGGG + Intergenic
969304429 4:6317722-6317744 CGCTCAGTAAGTAGTCCCTAAGG + Intergenic
972290036 4:37683420-37683442 CTGGAAGTAAGTATTTCACAGGG + Intronic
972450856 4:39196887-39196909 CTTTAAGTGAGTAGACCCCAAGG - Intronic
974066964 4:57087519-57087541 CTATCAGCAAGTAGTGCCCAGGG - Intronic
981066404 4:140491175-140491197 CTGTAAGTAAGCAGAATCCAAGG - Intronic
982392065 4:154875671-154875693 CTGGAAATAAGTAGTCCAGAAGG + Intergenic
983195446 4:164801241-164801263 CTGTGGATAAGTAGTTCCCATGG - Intergenic
983732082 4:171008126-171008148 CAGTAAGAAAGCAGTCCCTAGGG + Intergenic
983998739 4:174215896-174215918 TTTTAGGCAAGTAGTCCCCAAGG - Intergenic
984288086 4:177759375-177759397 CTGTTAGTAACTAGGCCACAAGG - Intronic
988540798 5:32107259-32107281 CTGTAAGTAAGTAGTCCCCATGG + Intronic
990092190 5:52065607-52065629 CTGTAGGTAAGAAGTACACATGG + Intronic
998523784 5:142824398-142824420 CTGGAAGTGTGTGGTCCCCAAGG + Intronic
1001216998 5:169865550-169865572 CTGTAAGTAAATCCTCCTCATGG - Intronic
1003376177 6:5579769-5579791 CTGAAAATAAGTAATCACCATGG + Intronic
1005794422 6:29343522-29343544 CTGTACATACATAGTCCCCAGGG + Intergenic
1006270124 6:32958004-32958026 CTGAAAGAAAGGAGTCCCAAAGG - Intronic
1012352166 6:98265876-98265898 CTGTAAATATTTAGTCCACATGG + Intergenic
1014589219 6:123242753-123242775 GTGTAAGTAAGTGTTTCCCAGGG + Intronic
1014659340 6:124148423-124148445 CTGTAAATCAGTAGTTGCCAGGG - Intronic
1038075813 8:24072425-24072447 CTGCAATTTAGTGGTCCCCAGGG + Intergenic
1039710762 8:40053974-40053996 GTGTAGGTAACTAGTCCCTAAGG - Intergenic
1043096618 8:75983467-75983489 ATCTCAGTAAGTAGTCACCATGG - Intergenic
1049767820 8:144363132-144363154 CTGTAAGTGAGCAGTGCTCAAGG - Intergenic
1052855156 9:33402405-33402427 CTGTAACTGAGAAGCCCCCAAGG - Exonic
1058610085 9:106766274-106766296 CTGTAAGAAAGAAATCCCTATGG + Intergenic
1059298206 9:113291471-113291493 CAGTAAGCAAGAAGTTCCCATGG - Exonic
1060728895 9:126024817-126024839 CTGTAAGGGAGCAGCCCCCAGGG - Intergenic
1061268302 9:129521328-129521350 CTGGCAGTAAGTAGGCACCAGGG + Intergenic
1196573714 X:117293674-117293696 CTGAAAGTAAGTATTCCACTGGG - Intergenic
1198318726 X:135497182-135497204 TTGTAAGCAAGGAGTCCACACGG - Intergenic
1199888523 X:152049326-152049348 CTGATAGTAAGTAGTCACAAAGG + Intergenic