ID: 988543363

View in Genome Browser
Species Human (GRCh38)
Location 5:32133413-32133435
Sequence GTTCCCAGCTGACCAAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988543363_988543366 20 Left 988543363 5:32133413-32133435 CCTTCTTTTGGTCAGCTGGGAAC 0: 1
1: 0
2: 0
3: 15
4: 107
Right 988543366 5:32133456-32133478 GCAACACCAGAAGCAGTCATGGG No data
988543363_988543368 30 Left 988543363 5:32133413-32133435 CCTTCTTTTGGTCAGCTGGGAAC 0: 1
1: 0
2: 0
3: 15
4: 107
Right 988543368 5:32133466-32133488 AAGCAGTCATGGGCCAACACTGG 0: 1
1: 0
2: 0
3: 6
4: 123
988543363_988543365 19 Left 988543363 5:32133413-32133435 CCTTCTTTTGGTCAGCTGGGAAC 0: 1
1: 0
2: 0
3: 15
4: 107
Right 988543365 5:32133455-32133477 TGCAACACCAGAAGCAGTCATGG 0: 1
1: 0
2: 1
3: 15
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988543363 Original CRISPR GTTCCCAGCTGACCAAAAGA AGG (reversed) Intronic
901075910 1:6554565-6554587 CCTCCCAGCTGCCGAAAAGAGGG + Intergenic
910085605 1:83398519-83398541 GTTTCCATGTGTCCAAAAGAGGG + Intergenic
912585318 1:110758633-110758655 TTTCAAAGGTGACCAAAAGATGG + Intergenic
913393194 1:118337280-118337302 GTTCACTGCTGAGCCAAAGAGGG + Intergenic
915507277 1:156365967-156365989 GTGACCAGCTGAGCAACAGAAGG - Intronic
915711268 1:157901378-157901400 ATTCCCAGATGAACAAAAGCTGG + Intergenic
917921406 1:179753685-179753707 GTTACCATCTGATGAAAAGAAGG + Intronic
919970936 1:202577867-202577889 GTTCCCAGCTTACCACAATTTGG - Intronic
923260286 1:232261697-232261719 GTTCCCTGCTGCCCCAAAGCTGG - Intergenic
924845368 1:247763364-247763386 GTTATCAGATCACCAAAAGAAGG + Intergenic
1065317890 10:24482477-24482499 GTTCCCACCCAACCTAAAGATGG + Intronic
1065520220 10:26564993-26565015 GTTCTCAGCTCACCAACACAAGG + Intronic
1067338550 10:45382947-45382969 GTTACCCACTGACAAAAAGAGGG - Intronic
1069636715 10:69929599-69929621 CTCCCCACCTGACCCAAAGAAGG + Intronic
1070187482 10:74079134-74079156 CTTCCCTGCATACCAAAAGATGG - Intronic
1070710137 10:78675299-78675321 GTCCCCAGGTGACCTAAAGAGGG - Intergenic
1076679387 10:132163797-132163819 GTACCCAGGGGTCCAAAAGAGGG - Intronic
1077895734 11:6451842-6451864 GCACCCAGGTGAACAAAAGAAGG + Intronic
1078536569 11:12179598-12179620 GCTCCCAGATGGGCAAAAGAAGG - Intronic
1079305267 11:19316141-19316163 GTTCCCTAGTGATCAAAAGATGG - Intergenic
1087285147 11:96257042-96257064 GTTTCCAGCAGACCAAAAATAGG + Intronic
1088140438 11:106609324-106609346 GATGCCAGGTGGCCAAAAGAGGG - Intergenic
1093963291 12:25299069-25299091 GTTCCCCACTGACCAAATGCAGG - Intergenic
1104517030 12:129437209-129437231 GTTCCCAACTGGCAGAAAGAGGG - Intronic
1109788600 13:67216865-67216887 GTTCCCAGCTGACACACAGAAGG + Intronic
1112775425 13:102838770-102838792 TTTCCCAGCTGACCAAAATGTGG + Intronic
1115344574 14:32328589-32328611 GTTCCCTGCAGGCCAAAGGAAGG + Intergenic
1117654824 14:57944177-57944199 GTACCAGGCTGACCAAAAGAGGG + Intronic
1118613164 14:67557092-67557114 GTTCCAATCTGAGCAAAAGAAGG - Intronic
1119423507 14:74522032-74522054 GTTGTCATCTGACCAGAAGAAGG + Exonic
1122517302 14:102317902-102317924 GTGCTCAGCTGAACAAAAGCCGG + Intronic
1122999046 14:105282250-105282272 GTCCCCAGCAAACCAAAGGAGGG + Intronic
1123899627 15:24863324-24863346 GTTCCCAGCTGCACAGAAGAAGG + Intronic
1127196387 15:56590803-56590825 GATACCAGCTGACCAACAGTAGG + Intergenic
1127243067 15:57140122-57140144 ATTCCCAGTTAACCAAAGGATGG + Intronic
1127891973 15:63260250-63260272 ATTTCCAGCTGCCCAAAAAAAGG - Intronic
1132400318 15:101501214-101501236 TTTCCCAGCTGAGCATAAAATGG + Intronic
1132580666 16:683351-683373 GTTCCCAGCAGGCCAAATGGGGG + Exonic
1134888430 16:17816345-17816367 GTCCCCAGCTGACCAGAAGTGGG + Intergenic
1135466584 16:22691576-22691598 GTTCCCATCTGGCCAACTGAAGG - Intergenic
1137384288 16:48027238-48027260 GTGCCCAGGTGATCAGAAGAGGG - Intergenic
1137398051 16:48131049-48131071 GTCCCCAGCTGGCCAACCGATGG - Intronic
1139148035 16:64345862-64345884 GTTCTCAGGGGACCAGAAGAGGG - Intergenic
1139165598 16:64561568-64561590 GTTCCAAACTGAGAAAAAGAAGG - Intergenic
1141093984 16:81149696-81149718 GGACCCAGCTGAGCAAAAGATGG - Intergenic
1141198071 16:81876524-81876546 GTTACCAGCTGGACAAGAGAAGG - Intronic
1144955190 17:19015518-19015540 GTTCCCAGCTGCGCCACAGAGGG + Intronic
1151746179 17:76013136-76013158 GTTCCCAGGTGAATAAAAGTGGG - Intronic
1152224354 17:79085815-79085837 GTTCCCCGCTGAACCCAAGAAGG - Intronic
1158410425 18:57200346-57200368 GGTCCCAGTAGACCAAAGGAAGG - Intergenic
1162243803 19:9381848-9381870 GTTTCCAGGTGACCATAACAGGG - Exonic
1164508046 19:28875413-28875435 GTTCCCAGCTGACCCAGATTTGG + Intergenic
932264368 2:70354255-70354277 GTTCCCAGATGAAGAAAAAAGGG + Intergenic
938621016 2:133053131-133053153 TTTACCAGCTAACCAAATGAAGG - Intronic
944499014 2:200338860-200338882 GAAACCAGATGACCAAAAGAGGG + Intronic
945627157 2:212224487-212224509 GCTGCCAGCTGAGCAAAAAAGGG + Intronic
946030774 2:216703013-216703035 CTTGCCAGCAGACCAAAAGTTGG - Intergenic
947145390 2:227059482-227059504 GGTCCCAGGTGACCAAATGCAGG + Exonic
1172082702 20:32355057-32355079 GTACCCTGCTGTCCAAATGACGG + Intergenic
1173234633 20:41233477-41233499 GTTCCCATCTGGCAACAAGATGG - Intronic
1173778357 20:45731621-45731643 AGTCCCAGCTAGCCAAAAGAAGG - Intergenic
1180704068 22:17798006-17798028 GTGTCCAGCAGACCAAAAGAGGG + Intronic
1182450422 22:30416835-30416857 TCTCCCAGCTGACCAAAGAATGG + Intronic
949235205 3:1800786-1800808 ATTCCAAGCAGAACAAAAGAAGG - Intergenic
949924267 3:9028536-9028558 ATTCCCAGCTGCCCACAAAAAGG + Intronic
951289029 3:20853185-20853207 GTTCAAAGTTGACCAAAACATGG - Intergenic
952017695 3:28977924-28977946 GTTGCCAGGTGATGAAAAGATGG - Intergenic
953434199 3:42865662-42865684 GTTCCCACCAGACCAAAATTTGG - Exonic
953875925 3:46666939-46666961 TTTCCCAGGTGCCCATAAGAGGG + Intergenic
954742842 3:52768285-52768307 GTTCCCAGATGGCAAGAAGATGG - Intronic
962342146 3:134594649-134594671 TTTCCTAGTTGAGCAAAAGAAGG + Intergenic
962661486 3:137605179-137605201 GTTCCCATCTGGCAGAAAGAAGG - Intergenic
962927090 3:140004933-140004955 GGTCCCAGTGGACCAATAGAAGG - Intronic
965211864 3:165801010-165801032 GTTCTCAGCTGAACTGAAGAAGG + Intronic
966963266 3:184962873-184962895 TTTGCAAGCTGATCAAAAGAAGG + Intronic
967017753 3:185497085-185497107 GTTCCCAGCAGATCAGATGATGG - Intronic
967903403 3:194480920-194480942 GATTCCAGCTCACCAAAAAAGGG + Intronic
969398993 4:6941133-6941155 TTTCCCAGCCCACCAACAGAAGG - Intronic
971329272 4:25669319-25669341 GTCCCCACCTTTCCAAAAGAAGG + Intronic
973080246 4:45982438-45982460 GTGACAACCTGACCAAAAGAGGG + Intergenic
974065956 4:57077564-57077586 CACCACAGCTGACCAAAAGAAGG + Intronic
976670743 4:87649963-87649985 GATCCCAGCAGACCCAAGGATGG - Intergenic
977142511 4:93391399-93391421 TTTCTCAGCTGAGAAAAAGAGGG - Intronic
979213262 4:118132466-118132488 GTTCCCCTCTGACCCACAGAAGG + Intronic
982588434 4:157272757-157272779 GAGCCCAGCTGACCTAGAGAAGG + Intronic
988543363 5:32133413-32133435 GTTCCCAGCTGACCAAAAGAAGG - Intronic
991021910 5:61988128-61988150 CTTAACAGCTGACCAGAAGATGG + Intergenic
995242824 5:109904314-109904336 GTTCCTAGCCCAGCAAAAGAGGG + Intergenic
996698693 5:126426647-126426669 TTCCCCAGCTCACCAACAGATGG - Intronic
1003599667 6:7505442-7505464 ATCCCCACCTGACCAAAAGAAGG - Intergenic
1003782253 6:9442674-9442696 GTTCCAAGATGGCCAAGAGATGG + Intergenic
1005856297 6:29865519-29865541 GTTCCCAGATGATCAAAACTGGG - Intergenic
1005949961 6:30624686-30624708 TATCCCAGCTCTCCAAAAGATGG + Intronic
1007730878 6:43945237-43945259 GTTCCCAGCTTGCCAAGAGGTGG + Intergenic
1012510537 6:99996147-99996169 GTTTCCAGCTGAGAAAAAAAAGG - Intergenic
1013065092 6:106676422-106676444 GATCCCACCTAACCATAAGAGGG - Intergenic
1026227042 7:68451309-68451331 GTTCCTAGAAGACCAAAAGATGG + Intergenic
1026415771 7:70179032-70179054 GTGCCCAGCTGAGCCAAAGGTGG - Intronic
1027302478 7:76854979-76855001 GTTTCCATGTGTCCAAAAGAGGG + Intergenic
1027648607 7:80836643-80836665 ATTCCAAGCTGAGCAACAGAGGG + Intronic
1029179395 7:98689044-98689066 GTTCCCAGCTGAAACACAGAGGG + Intergenic
1029207943 7:98880031-98880053 GCTCCCAGCTGACACACAGATGG - Intronic
1031120542 7:117716651-117716673 GTTCCCAGTTGAACAAAAAAAGG + Intronic
1031754371 7:125619082-125619104 GATCCCAGGAGACCAAAAGATGG - Intergenic
1036628584 8:10494029-10494051 GTTCCCAGTAGTCCAAGAGATGG + Intergenic
1038502609 8:28058475-28058497 GTTCACAGCTGACAAAACGCTGG - Intronic
1039395998 8:37225632-37225654 GCTCCCAGCTGAGAAAATGATGG + Intergenic
1048334616 8:133493156-133493178 GTCCCCAGCTGATCATTAGAAGG + Intronic
1049305616 8:141902228-141902250 CTTCCCAGCTGCCCTACAGATGG - Intergenic
1051659158 9:19409496-19409518 GCCCCCAGCTGACCCAAACAAGG - Intronic
1052634816 9:31088602-31088624 TTTCCCAATTGACCAGAAGATGG + Intergenic
1054922140 9:70553533-70553555 GTTATCACCTGACCAGAAGAGGG + Intronic
1055740816 9:79387023-79387045 TTTCCCTCCTGTCCAAAAGAGGG + Intergenic
1057187275 9:93063803-93063825 GTAGCCAGCTGACCAGAAGAAGG - Intronic
1061093925 9:128443461-128443483 CTGCCCAGCTGCCCCAAAGAGGG - Intergenic
1188500619 X:30821756-30821778 GTTCCCAGCTAGTCACAAGAAGG + Intergenic
1189712947 X:43833508-43833530 GGGCCCAGCTCACCAAAAGATGG - Intronic
1190380858 X:49838602-49838624 GTGCCCCACTGACCACAAGATGG - Intergenic
1191849834 X:65578062-65578084 ATACCCAGCTGTACAAAAGATGG + Intergenic
1192136047 X:68601587-68601609 TTTCCCAGATAAACAAAAGATGG + Intergenic
1193417708 X:81243826-81243848 GTTTCCTGATGTCCAAAAGAGGG - Intronic
1198299007 X:135316218-135316240 TTTCCCAGATGAGCAAAAGCTGG - Intronic
1199588744 X:149445256-149445278 GATCCCAACAGACCAAAAAATGG + Intergenic