ID: 988544643

View in Genome Browser
Species Human (GRCh38)
Location 5:32143800-32143822
Sequence TTGAATTAGCATTGAGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988544643 Original CRISPR TTGAATTAGCATTGAGAGGA AGG (reversed) Exonic
902157942 1:14504906-14504928 TTGAACTAGCATAGACAGAATGG + Intergenic
906551031 1:46666668-46666690 TTGAAAAAGAATGGAGAGGAGGG - Intronic
907182680 1:52584598-52584620 ATGAAGAAGCATGGAGAGGAAGG + Intergenic
911627565 1:100142414-100142436 TTGCATTGGGATGGAGAGGAGGG + Intronic
913520152 1:119637839-119637861 TTGAATTAGCATTGAGTTAATGG + Intronic
913524236 1:119675950-119675972 ATGAATTGGCATTGGGAAGAAGG + Intronic
914233485 1:145787247-145787269 TTAGAATAGCATTGATAGGATGG - Intronic
919285102 1:195548021-195548043 TTGAAATAGTATTGAGAACAAGG + Intergenic
920419335 1:205820474-205820496 TTGACTAAGCAGGGAGAGGAGGG - Intergenic
921588603 1:216977769-216977791 TTGTAATAGCATTAAGAGGTGGG + Intronic
922874977 1:228933508-228933530 TTGAATAAGCACTGAGTTGATGG - Intergenic
924948832 1:248864269-248864291 CTGAATGAGCAGTGTGAGGAGGG - Intergenic
1064904539 10:20331383-20331405 TTGCAACAGCATTGAGAGGTGGG + Intergenic
1065096478 10:22285969-22285991 TTGAATTACAAATGGGAGGAGGG + Intergenic
1067932576 10:50577551-50577573 TTGCATTAAAATTAAGAGGAAGG - Intronic
1069298473 10:66877101-66877123 ATGAAGTAGGAGTGAGAGGAGGG - Intronic
1069912702 10:71769576-71769598 TGGAATTAACCTTCAGAGGAGGG + Intronic
1074444064 10:113504060-113504082 TTTATTCAGCATTTAGAGGAAGG - Intergenic
1075786744 10:125055111-125055133 GTGAATTACCATTCAGAGGGGGG - Intronic
1078544848 11:12240014-12240036 TTGAAGGAGCTTTGAGAGGCTGG + Intronic
1080681740 11:34483203-34483225 TTGAAACAGGATTGAGATGAGGG - Intronic
1080908364 11:36569754-36569776 TAGAATTGGCATTGATAAGAGGG - Intronic
1081267343 11:41041335-41041357 ATGAATTAGGAATGAGAGAAAGG + Intronic
1086595108 11:88561265-88561287 TTTAATTAGCATTGTCACGAGGG - Intronic
1087444361 11:98229185-98229207 ATGCAATAGCATTGAGAGGTAGG - Intergenic
1087815751 11:102656605-102656627 TTGAATTAGCATTTAGTGACAGG + Intergenic
1090537716 11:127662711-127662733 TTGAATTGGTATTGAGAAGTAGG - Intergenic
1090721901 11:129482966-129482988 TTGGCTTAGCAGTAAGAGGATGG - Intergenic
1093151942 12:15632168-15632190 ATAAATTAGCATTAAGATGATGG - Intronic
1096401740 12:51313169-51313191 TTGAGGTTGCAGTGAGAGGAAGG + Intronic
1096652545 12:53069004-53069026 TTGAATGAGCAATGAGGGGCTGG - Intronic
1097357252 12:58615502-58615524 TTGAATTACACTTCAGAGGAAGG - Intronic
1099046872 12:77731928-77731950 TACATTTAGCATTGAGGGGAAGG + Intergenic
1099827569 12:87797757-87797779 TTGAATTAGGATTCGGAGGTAGG + Intergenic
1100895012 12:99171800-99171822 TTGAATCCCCATTGAGAAGAAGG + Intronic
1101577870 12:106014503-106014525 TTGATATAACATTGAGAGGAGGG + Intergenic
1102412429 12:112731656-112731678 CTAAATTAGAAGTGAGAGGAAGG - Intronic
1102618674 12:114176430-114176452 TAGCATAACCATTGAGAGGAAGG - Intergenic
1103145416 12:118591033-118591055 TTGGATTAGCCTTGAGAAGGAGG + Intergenic
1105035952 12:132921121-132921143 TTTAATTAGCCATGAGAGGCTGG - Intronic
1108276324 13:48813828-48813850 TTGGATTGGCATTGAGTAGAAGG + Intergenic
1109219421 13:59626188-59626210 TGGATTTGGGATTGAGAGGAAGG + Intergenic
1110121018 13:71881865-71881887 TGGAATTATCACTGAGAGGAAGG - Intergenic
1111744483 13:92249579-92249601 ATGGATTAGCATTGAGGGGATGG + Intronic
1112725707 13:102302062-102302084 TTGAACAAGCAGTGTGAGGAAGG - Intronic
1113004483 13:105683634-105683656 TTGAATATGGATTCAGAGGATGG + Intergenic
1114146797 14:19986384-19986406 TTGAATTTGCATTGTTTGGATGG - Intergenic
1114553471 14:23547765-23547787 TTGAATTAGTAGGGAGAGGCTGG - Intronic
1118648381 14:67863640-67863662 TTTTTTTAACATTGAGAGGAAGG - Intronic
1119051588 14:71374851-71374873 TAAAATTATCATTGAGAGGATGG - Intronic
1119979658 14:79065475-79065497 TTGAATTTTCACTGAGAGGCAGG + Intronic
1121023468 14:90597293-90597315 TTGAATTAGTATTGGAAGGAGGG + Intronic
1121454292 14:94028330-94028352 TTGAACTTGCATTGTGTGGATGG + Intronic
1121706644 14:96001362-96001384 TTAAATAAGCATGGTGAGGAGGG - Intergenic
1123763774 15:23454403-23454425 ATGGATTAGCATTGAGGGAATGG + Intergenic
1124773902 15:32569327-32569349 TTGAAACAGTATTGAGAGGTGGG + Intergenic
1125292770 15:38167908-38167930 TGGATTTAGGATTGAGGGGAAGG - Intergenic
1125317515 15:38446920-38446942 TTGTAATAGTATTAAGAGGATGG - Intergenic
1126744691 15:51814150-51814172 TTGACTAAGAATTGAGGGGAGGG + Exonic
1127369184 15:58321074-58321096 ATGAAATAGAATTGAAAGGAGGG + Intronic
1127675336 15:61232685-61232707 TAGAATTAACTTTGAAAGGAAGG - Intergenic
1131341894 15:91610248-91610270 GTGACTTAACATTGAGAAGACGG - Intergenic
1131747149 15:95460887-95460909 TTACAGTAGAATTGAGAGGAAGG - Intergenic
1132074014 15:98804506-98804528 TTGATTCTGCTTTGAGAGGATGG + Intronic
1135349961 16:21720559-21720581 TTGCATCAGCATTGTGTGGAAGG + Intronic
1137398002 16:48130659-48130681 TTGAGTTGACATTGGGAGGAGGG - Intronic
1140743210 16:77960017-77960039 TTGAGCTAGGATTTAGAGGATGG - Intronic
1140798039 16:78458819-78458841 TGGAATTAGCATGTAGAGGTTGG + Intronic
1146394574 17:32453566-32453588 TTGAATTAGCATTCTCTGGAGGG + Intronic
1147344651 17:39781529-39781551 ATGATTTGGCAGTGAGAGGAGGG - Intronic
1147468070 17:40627390-40627412 TTGAATTATCTTTGAAAGAATGG - Exonic
1149440256 17:56667886-56667908 TTGAATTAGTTTTAAAAGGATGG - Intergenic
1150016799 17:61565284-61565306 TTGAATTAGCATTAGTAGTAGGG + Intergenic
1150883804 17:69062016-69062038 TTGAATCAATATTGAGAGAATGG - Intergenic
1153440354 18:5111005-5111027 TGAAATTAGTATTTAGAGGAAGG - Intergenic
1155083835 18:22436041-22436063 TAGAGATAGCATTGATAGGAAGG - Intergenic
1155450899 18:25961645-25961667 TGGAACTATCATTGACAGGAAGG - Intergenic
1159321230 18:66851878-66851900 ATGAATTATAATTTAGAGGATGG + Intergenic
1164538602 19:29105706-29105728 TTGATTTACCATTGAGAAGCTGG + Intergenic
1165267864 19:34676966-34676988 TTGAGTGAGCACTGGGAGGATGG - Intergenic
1166494079 19:43285743-43285765 ATGAATTAGCCTTGGGAGTAGGG - Intergenic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1168439935 19:56355839-56355861 TTGAATCAGGATTGGGAAGAAGG + Intronic
929373582 2:41256678-41256700 ATGAATTTGCATTGATAGCAGGG + Intergenic
931155215 2:59620806-59620828 TTGTATTAGGATTCAGAGCAGGG - Intergenic
939032870 2:137097274-137097296 TTTTCTTAGCATTGACAGGAAGG - Intronic
939902905 2:147872070-147872092 TTGAGTTAGCATTGAAAATATGG + Intronic
942656552 2:178219888-178219910 TTGAAATAGCATTGCTCGGAAGG - Intronic
944332145 2:198482653-198482675 TTTCATTTCCATTGAGAGGAAGG + Intronic
945327754 2:208502234-208502256 TTGCAGCAGCTTTGAGAGGAAGG + Intronic
946222712 2:218242253-218242275 TGGAATAAGCATTGAAATGATGG - Intronic
947476479 2:230453014-230453036 TTTTATTAGCAGTGTGAGGATGG - Intronic
1169098762 20:2927505-2927527 TTGAACTAGCCTTGACAGGCTGG - Intronic
1170012952 20:11747338-11747360 TTGAGTTTGCAATGAAAGGATGG + Intergenic
1173345455 20:42195306-42195328 TTGAGGCAGCATTGAGAGGTAGG - Intronic
1174623981 20:51899232-51899254 GTAAATTAGCATTGGGAGGATGG + Intergenic
1174646478 20:52090330-52090352 TTGAATTAGCATTCAGTGAGAGG + Intronic
1177889096 21:26783077-26783099 TTGAATTAGCTTTAAAAGTAAGG - Intergenic
1178005864 21:28219154-28219176 CTGAAGCAGCATTGAGAGAATGG - Intergenic
1178508144 21:33179875-33179897 TTGATTTCTCATTGATAGGATGG + Intergenic
1179326905 21:40355582-40355604 TTGAATTAGAAGAGAGAGCAGGG - Intronic
1179433311 21:41340551-41340573 TGGAAATAGCATTAAGAGGTGGG - Intronic
1181549844 22:23631588-23631610 TTGAATTTTCATTGAGAAAAGGG + Intronic
1181798548 22:25327939-25327961 TTGAATTTTCATTGAGAAAAGGG - Intergenic
950095750 3:10329253-10329275 TGTTATTAGCATTGACAGGATGG + Intronic
951118517 3:18894694-18894716 TTGAAAAGGCATGGAGAGGATGG + Intergenic
956197870 3:66671575-66671597 ATGACTTGGCTTTGAGAGGATGG - Intergenic
958931560 3:100213172-100213194 TTGAATTAACGTTTTGAGGAAGG + Intergenic
959270559 3:104203935-104203957 TAGAATTAATATTGATAGGAAGG - Intergenic
960521386 3:118659394-118659416 TTGAATTAGATTTCAGAGTAAGG + Intergenic
962928012 3:140012798-140012820 TTGAATTAACACAGTGAGGAAGG + Intronic
963790727 3:149579774-149579796 TTGTTTTAACATTAAGAGGATGG - Intronic
964427738 3:156571056-156571078 TTGAATTAGAAGTGAAACGAGGG - Intergenic
964474054 3:157083072-157083094 AAAAATTAGCATAGAGAGGATGG + Intergenic
964738724 3:159943417-159943439 CTGAATTAGCACAGAAAGGATGG - Intergenic
966175786 3:177136578-177136600 TTGATTAAAAATTGAGAGGATGG - Intronic
966198377 3:177336176-177336198 TTGTATTAGAAATTAGAGGAAGG - Intergenic
966315629 3:178642461-178642483 TTGAATTAATACTGTGAGGAAGG - Intronic
966888866 3:184391798-184391820 TTGAATGGGCATTGAATGGATGG - Intronic
967469153 3:189842638-189842660 TTTAATCAGCACTGAGAAGAGGG + Intronic
967582913 3:191180313-191180335 CTGTATTAGCAGTGTGAGGACGG + Intergenic
970151451 4:13094773-13094795 TTGCAATAGTATTGAGAGGTGGG - Intergenic
970493980 4:16607199-16607221 TTGAAATGGCATTGAGAAAAGGG - Intronic
970910138 4:21265272-21265294 TTGCATAAGAAGTGAGAGGATGG + Intronic
971783000 4:31062552-31062574 TTGATTTGGCACTGAGAGGCAGG - Intronic
974865962 4:67581016-67581038 TTGAATTAGCTTTTAGTGCAAGG + Intronic
975241724 4:72067148-72067170 TTGAATTAGCATCGTGTGGATGG + Intronic
977265909 4:94854001-94854023 TTTAATTTGCAATAAGAGGAAGG - Intronic
977738773 4:100451365-100451387 TTGAATCAGCATTTAGAGGTAGG + Intronic
978386766 4:108183617-108183639 GGGAATTAGAATTGATAGGAGGG + Intergenic
982385113 4:154792647-154792669 TTGATTTAGAGTTGAGAGGGAGG + Intronic
982720724 4:158856970-158856992 TTGATTTAGAATTCAGTGGAGGG + Intronic
984043273 4:174764466-174764488 GTCAATTAAAATTGAGAGGATGG - Intronic
984607034 4:181797185-181797207 TTCTTTTAGGATTGAGAGGAAGG - Intergenic
987919896 5:24265697-24265719 TCAAATTAGCATGGAAAGGATGG + Intergenic
988544643 5:32143800-32143822 TTGAATTAGCATTGAGAGGAAGG - Exonic
992542656 5:77779911-77779933 TTGAATTACAAAAGAGAGGAGGG - Intronic
994474696 5:100251739-100251761 TAGAATTAGTAATGAGAAGAGGG - Intergenic
998777695 5:145620524-145620546 TTAAAGTAAAATTGAGAGGAGGG - Intronic
999642626 5:153687170-153687192 TGGAATTAGCAATGTGATGAAGG - Intronic
1000227522 5:159280119-159280141 TGGAATTAGAATTTAGGGGATGG - Intronic
1001310045 5:170604046-170604068 TTGAAGTAGGATGGAGAGGAAGG + Intronic
1002926414 6:1608219-1608241 TAGAATTAGCCTTTGGAGGAGGG - Intergenic
1004377636 6:15104488-15104510 TAGATTTGGCCTTGAGAGGATGG - Intergenic
1007344698 6:41220466-41220488 TTGAATTAGAATGGTGAGAATGG + Intergenic
1007643175 6:43359535-43359557 GTGAATTATCATCTAGAGGATGG + Intronic
1007940108 6:45772635-45772657 TTGAATTAACATTGACTGAATGG - Intergenic
1009857450 6:69282958-69282980 TTGAGCTAGCATAGACAGGATGG + Intronic
1012372651 6:98526179-98526201 TTGGCTCAGCAGTGAGAGGAGGG + Intergenic
1012642780 6:101641075-101641097 TTGAATTAGCTTTAATATGAAGG + Intronic
1012716649 6:102681810-102681832 CTGAATCAGAATTTAGAGGAGGG + Intergenic
1014169977 6:118267725-118267747 TTTAATTTGCTTTGCGAGGAGGG + Intronic
1015980043 6:138829417-138829439 TTGAATTTGAATTGAGAGTATGG - Intronic
1016732112 6:147438389-147438411 TGGCATTAGAATTGTGAGGAAGG - Intergenic
1018603276 6:165569662-165569684 TTGAAGTAGATTTAAGAGGAGGG - Intronic
1020491254 7:8786866-8786888 TTGAATTAGCAGTTACAGGATGG - Intergenic
1020891201 7:13880048-13880070 TTGAATTAGAATTTGGAGGTAGG + Intergenic
1022232389 7:28426850-28426872 TCGAATTAGCATAGAGTAGATGG + Intronic
1022481934 7:30749939-30749961 TTGCAGTAGCCTGGAGAGGATGG - Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1024358235 7:48440281-48440303 TTCAATTACCCTTGTGAGGAGGG - Intronic
1024758877 7:52569765-52569787 TTCAATAAGCATTGTGAGGTTGG + Intergenic
1026120963 7:67536929-67536951 TTTAATTAGCATTGCGCTGAAGG - Intergenic
1028940536 7:96517348-96517370 TTGCATCAAAATTGAGAGGAAGG - Intronic
1029871381 7:103696653-103696675 CAGAATTAGGAGTGAGAGGATGG - Intronic
1030377630 7:108771615-108771637 GTGAACTTGCATTGAGAGCAAGG + Intergenic
1030673146 7:112359203-112359225 TAGAATTAGATTTGGGAGGAAGG - Intergenic
1030704222 7:112674682-112674704 TTGTAATAGTATTAAGAGGATGG - Intergenic
1030957681 7:115875325-115875347 TTGAATTAGAAATGAGAACATGG + Intergenic
1031061947 7:117061644-117061666 TTGAATTAGTAATTAAAGGAAGG + Intronic
1031320503 7:120320753-120320775 TGGAAATAGGATTTAGAGGAAGG + Intronic
1034388032 7:150756611-150756633 TTGATTTAGTTTGGAGAGGAGGG + Intergenic
1035415688 7:158683655-158683677 TTGAACTAGCCTTGAGTGGTAGG - Intronic
1036479308 8:9124098-9124120 CTGAATTAGGAAAGAGAGGAAGG + Intergenic
1038076382 8:24079993-24080015 TAGAATTAGCATTGAGGTGCAGG + Intergenic
1038430969 8:27499228-27499250 TTAAATTAAAATTGAGAGGTGGG - Intronic
1039582363 8:38677344-38677366 TTGACTTAGATTTGAGGGGATGG - Intergenic
1040654586 8:49491670-49491692 TTACATTATCATTGTGAGGAAGG + Intergenic
1041300443 8:56406120-56406142 TTGTAATAGTATTGAGAGGTGGG + Intergenic
1042491412 8:69402681-69402703 TTGAAGTAGCTTAGAGAAGAAGG - Intergenic
1043790551 8:84462396-84462418 TTGAAATACAATTCAGAGGACGG - Intronic
1044756003 8:95461816-95461838 TGGTTTGAGCATTGAGAGGAGGG + Intergenic
1045025558 8:98083461-98083483 CTCAATTAGAATTGAGGGGAGGG - Intronic
1047360485 8:124164515-124164537 TTGAATTAACAAAGGGAGGAGGG - Intergenic
1048660254 8:136591772-136591794 TTCAGTTAACATTGAGAGTAAGG - Intergenic
1055356070 9:75438239-75438261 TTTAATTAGAAAGGAGAGGAAGG + Intergenic
1055722044 9:79186061-79186083 ATGCATTAGCTTTGAGGGGAAGG - Intergenic
1056618395 9:88188508-88188530 TTAAATTAGCACTTAGAAGACGG - Intergenic
1058398869 9:104590243-104590265 GTGTATCAGCATTGAGGGGATGG - Intergenic
1058788274 9:108413882-108413904 TTTAATTCCCATTGAAAGGAAGG - Intergenic
1059243182 9:112826117-112826139 CTGAATAAGACTTGAGAGGATGG - Intronic
1059935124 9:119302713-119302735 TTGAAGTAGGGTTTAGAGGAGGG - Intronic
1060287138 9:122263990-122264012 TTGAATTAGCATTTAGTAGGAGG - Intronic
1061454503 9:130687611-130687633 TTGAATGAGCCTTGAAATGAGGG - Intergenic
1185774968 X:2794635-2794657 TTGAATTTGCACAGAGAGGGTGG + Intronic
1188881359 X:35496033-35496055 ATGCATGAGAATTGAGAGGAAGG + Intergenic
1189407511 X:40738074-40738096 TTTAATTTGCATAGAGAGGCAGG + Intergenic
1189648381 X:43159606-43159628 TTAAATTAGGAAGGAGAGGAAGG - Intergenic
1191915832 X:66200384-66200406 TTAAAGTGGCATAGAGAGGAAGG + Intronic
1193435382 X:81469011-81469033 GTGAATGAGCATTAAGTGGAAGG - Intergenic
1195315533 X:103674081-103674103 TTGAATTAGTAGTGAAAGAATGG - Intergenic
1195878624 X:109569399-109569421 TTAAATAAGCATATAGAGGATGG + Intergenic
1196486987 X:116223472-116223494 ATGAATTAGCTTTGATAAGAAGG + Intergenic
1200243470 X:154509818-154509840 ATGTATTGGTATTGAGAGGAGGG - Intronic