ID: 988545243

View in Genome Browser
Species Human (GRCh38)
Location 5:32150367-32150389
Sequence AAATAGCAACAGATTTTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988545240_988545243 7 Left 988545240 5:32150337-32150359 CCTAAGTTAATAAATGTAATATC 0: 1
1: 0
2: 1
3: 48
4: 564
Right 988545243 5:32150367-32150389 AAATAGCAACAGATTTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988545243 Original CRISPR AAATAGCAACAGATTTTCCC TGG Intronic
No off target data available for this crispr