ID: 988550346

View in Genome Browser
Species Human (GRCh38)
Location 5:32195313-32195335
Sequence TCTTAGCTCTTGAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988550341_988550346 23 Left 988550341 5:32195267-32195289 CCTAAGTGTGAATTTGAGGATTT No data
Right 988550346 5:32195313-32195335 TCTTAGCTCTTGAAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988550346 Original CRISPR TCTTAGCTCTTGAAGGAGGA TGG Intergenic
No off target data available for this crispr