ID: 988551465

View in Genome Browser
Species Human (GRCh38)
Location 5:32204537-32204559
Sequence CAAAGGGTCTTGTGCAGGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988551465_988551477 20 Left 988551465 5:32204537-32204559 CCCGTCCTGCACAAGACCCTTTG No data
Right 988551477 5:32204580-32204602 GCTCCTCCAGACCACTCTTGGGG No data
988551465_988551481 26 Left 988551465 5:32204537-32204559 CCCGTCCTGCACAAGACCCTTTG No data
Right 988551481 5:32204586-32204608 CCAGACCACTCTTGGGGGTATGG No data
988551465_988551475 18 Left 988551465 5:32204537-32204559 CCCGTCCTGCACAAGACCCTTTG No data
Right 988551475 5:32204578-32204600 CCGCTCCTCCAGACCACTCTTGG No data
988551465_988551476 19 Left 988551465 5:32204537-32204559 CCCGTCCTGCACAAGACCCTTTG No data
Right 988551476 5:32204579-32204601 CGCTCCTCCAGACCACTCTTGGG No data
988551465_988551478 21 Left 988551465 5:32204537-32204559 CCCGTCCTGCACAAGACCCTTTG No data
Right 988551478 5:32204581-32204603 CTCCTCCAGACCACTCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988551465 Original CRISPR CAAAGGGTCTTGTGCAGGAC GGG (reversed) Intergenic