ID: 988551466

View in Genome Browser
Species Human (GRCh38)
Location 5:32204538-32204560
Sequence CCAAAGGGTCTTGTGCAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988551466_988551476 18 Left 988551466 5:32204538-32204560 CCGTCCTGCACAAGACCCTTTGG No data
Right 988551476 5:32204579-32204601 CGCTCCTCCAGACCACTCTTGGG No data
988551466_988551478 20 Left 988551466 5:32204538-32204560 CCGTCCTGCACAAGACCCTTTGG No data
Right 988551478 5:32204581-32204603 CTCCTCCAGACCACTCTTGGGGG No data
988551466_988551475 17 Left 988551466 5:32204538-32204560 CCGTCCTGCACAAGACCCTTTGG No data
Right 988551475 5:32204578-32204600 CCGCTCCTCCAGACCACTCTTGG No data
988551466_988551481 25 Left 988551466 5:32204538-32204560 CCGTCCTGCACAAGACCCTTTGG No data
Right 988551481 5:32204586-32204608 CCAGACCACTCTTGGGGGTATGG No data
988551466_988551477 19 Left 988551466 5:32204538-32204560 CCGTCCTGCACAAGACCCTTTGG No data
Right 988551477 5:32204580-32204602 GCTCCTCCAGACCACTCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988551466 Original CRISPR CCAAAGGGTCTTGTGCAGGA CGG (reversed) Intergenic