ID: 988551468

View in Genome Browser
Species Human (GRCh38)
Location 5:32204542-32204564
Sequence GAATCCAAAGGGTCTTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988551468_988551476 14 Left 988551468 5:32204542-32204564 CCTGCACAAGACCCTTTGGATTC No data
Right 988551476 5:32204579-32204601 CGCTCCTCCAGACCACTCTTGGG No data
988551468_988551475 13 Left 988551468 5:32204542-32204564 CCTGCACAAGACCCTTTGGATTC No data
Right 988551475 5:32204578-32204600 CCGCTCCTCCAGACCACTCTTGG No data
988551468_988551477 15 Left 988551468 5:32204542-32204564 CCTGCACAAGACCCTTTGGATTC No data
Right 988551477 5:32204580-32204602 GCTCCTCCAGACCACTCTTGGGG No data
988551468_988551481 21 Left 988551468 5:32204542-32204564 CCTGCACAAGACCCTTTGGATTC No data
Right 988551481 5:32204586-32204608 CCAGACCACTCTTGGGGGTATGG No data
988551468_988551478 16 Left 988551468 5:32204542-32204564 CCTGCACAAGACCCTTTGGATTC No data
Right 988551478 5:32204581-32204603 CTCCTCCAGACCACTCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988551468 Original CRISPR GAATCCAAAGGGTCTTGTGC AGG (reversed) Intergenic
No off target data available for this crispr