ID: 988551470

View in Genome Browser
Species Human (GRCh38)
Location 5:32204554-32204576
Sequence GAGAGGGTCAAGGAATCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988551470_988551476 2 Left 988551470 5:32204554-32204576 CCTTTGGATTCCTTGACCCTCTC No data
Right 988551476 5:32204579-32204601 CGCTCCTCCAGACCACTCTTGGG No data
988551470_988551475 1 Left 988551470 5:32204554-32204576 CCTTTGGATTCCTTGACCCTCTC No data
Right 988551475 5:32204578-32204600 CCGCTCCTCCAGACCACTCTTGG No data
988551470_988551478 4 Left 988551470 5:32204554-32204576 CCTTTGGATTCCTTGACCCTCTC No data
Right 988551478 5:32204581-32204603 CTCCTCCAGACCACTCTTGGGGG No data
988551470_988551477 3 Left 988551470 5:32204554-32204576 CCTTTGGATTCCTTGACCCTCTC No data
Right 988551477 5:32204580-32204602 GCTCCTCCAGACCACTCTTGGGG No data
988551470_988551481 9 Left 988551470 5:32204554-32204576 CCTTTGGATTCCTTGACCCTCTC No data
Right 988551481 5:32204586-32204608 CCAGACCACTCTTGGGGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988551470 Original CRISPR GAGAGGGTCAAGGAATCCAA AGG (reversed) Intergenic