ID: 988551472

View in Genome Browser
Species Human (GRCh38)
Location 5:32204570-32204592
Sequence GGTCTGGAGGAGCGGAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988551472_988551481 -7 Left 988551472 5:32204570-32204592 CCCTCTCTCCGCTCCTCCAGACC No data
Right 988551481 5:32204586-32204608 CCAGACCACTCTTGGGGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988551472 Original CRISPR GGTCTGGAGGAGCGGAGAGA GGG (reversed) Intergenic