ID: 988551476

View in Genome Browser
Species Human (GRCh38)
Location 5:32204579-32204601
Sequence CGCTCCTCCAGACCACTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988551468_988551476 14 Left 988551468 5:32204542-32204564 CCTGCACAAGACCCTTTGGATTC No data
Right 988551476 5:32204579-32204601 CGCTCCTCCAGACCACTCTTGGG No data
988551465_988551476 19 Left 988551465 5:32204537-32204559 CCCGTCCTGCACAAGACCCTTTG No data
Right 988551476 5:32204579-32204601 CGCTCCTCCAGACCACTCTTGGG No data
988551466_988551476 18 Left 988551466 5:32204538-32204560 CCGTCCTGCACAAGACCCTTTGG No data
Right 988551476 5:32204579-32204601 CGCTCCTCCAGACCACTCTTGGG No data
988551464_988551476 20 Left 988551464 5:32204536-32204558 CCCCGTCCTGCACAAGACCCTTT No data
Right 988551476 5:32204579-32204601 CGCTCCTCCAGACCACTCTTGGG No data
988551470_988551476 2 Left 988551470 5:32204554-32204576 CCTTTGGATTCCTTGACCCTCTC No data
Right 988551476 5:32204579-32204601 CGCTCCTCCAGACCACTCTTGGG No data
988551471_988551476 -8 Left 988551471 5:32204564-32204586 CCTTGACCCTCTCTCCGCTCCTC No data
Right 988551476 5:32204579-32204601 CGCTCCTCCAGACCACTCTTGGG No data
988551469_988551476 3 Left 988551469 5:32204553-32204575 CCCTTTGGATTCCTTGACCCTCT No data
Right 988551476 5:32204579-32204601 CGCTCCTCCAGACCACTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988551476 Original CRISPR CGCTCCTCCAGACCACTCTT GGG Intergenic
No off target data available for this crispr