ID: 988551481

View in Genome Browser
Species Human (GRCh38)
Location 5:32204586-32204608
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988551470_988551481 9 Left 988551470 5:32204554-32204576 CCTTTGGATTCCTTGACCCTCTC No data
Right 988551481 5:32204586-32204608 CCAGACCACTCTTGGGGGTATGG No data
988551468_988551481 21 Left 988551468 5:32204542-32204564 CCTGCACAAGACCCTTTGGATTC No data
Right 988551481 5:32204586-32204608 CCAGACCACTCTTGGGGGTATGG No data
988551466_988551481 25 Left 988551466 5:32204538-32204560 CCGTCCTGCACAAGACCCTTTGG No data
Right 988551481 5:32204586-32204608 CCAGACCACTCTTGGGGGTATGG No data
988551465_988551481 26 Left 988551465 5:32204537-32204559 CCCGTCCTGCACAAGACCCTTTG No data
Right 988551481 5:32204586-32204608 CCAGACCACTCTTGGGGGTATGG No data
988551472_988551481 -7 Left 988551472 5:32204570-32204592 CCCTCTCTCCGCTCCTCCAGACC No data
Right 988551481 5:32204586-32204608 CCAGACCACTCTTGGGGGTATGG No data
988551471_988551481 -1 Left 988551471 5:32204564-32204586 CCTTGACCCTCTCTCCGCTCCTC No data
Right 988551481 5:32204586-32204608 CCAGACCACTCTTGGGGGTATGG No data
988551469_988551481 10 Left 988551469 5:32204553-32204575 CCCTTTGGATTCCTTGACCCTCT No data
Right 988551481 5:32204586-32204608 CCAGACCACTCTTGGGGGTATGG No data
988551464_988551481 27 Left 988551464 5:32204536-32204558 CCCCGTCCTGCACAAGACCCTTT No data
Right 988551481 5:32204586-32204608 CCAGACCACTCTTGGGGGTATGG No data
988551473_988551481 -8 Left 988551473 5:32204571-32204593 CCTCTCTCCGCTCCTCCAGACCA No data
Right 988551481 5:32204586-32204608 CCAGACCACTCTTGGGGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type