ID: 988554169

View in Genome Browser
Species Human (GRCh38)
Location 5:32222004-32222026
Sequence ATTGTGAAGAACAATGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 1, 2: 4, 3: 29, 4: 343}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988554167_988554169 11 Left 988554167 5:32221970-32221992 CCTGGCTGGAGGCTACGCTGGAC 0: 1
1: 0
2: 1
3: 20
4: 132
Right 988554169 5:32222004-32222026 ATTGTGAAGAACAATGATGATGG 0: 1
1: 1
2: 4
3: 29
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988554169 Original CRISPR ATTGTGAAGAACAATGATGA TGG Intergenic
901371073 1:8798554-8798576 ATCATGAAGAACACTGATGATGG + Intronic
902327400 1:15710636-15710658 ATTTTGAAAAAGAATGTTGAGGG + Intronic
902548577 1:17205891-17205913 ATGGTGATGAACAGTGATGATGG + Intronic
902803210 1:18844144-18844166 ATTCTGAAGGACAGTAATGATGG + Intronic
904373211 1:30063847-30063869 ATTGTTCAGTCCAATGATGAGGG + Intergenic
904420274 1:30386683-30386705 AATGTGCAGAACAAGGAAGATGG + Intergenic
905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG + Intergenic
905274148 1:36806244-36806266 CTGGTGAAGAACAACGAGGAGGG - Exonic
905639487 1:39578839-39578861 ATAGTGATTAACAATGTTGACGG - Intergenic
905926993 1:41758250-41758272 ATTGTGAAGATCTCTTATGAGGG - Intronic
906849111 1:49228777-49228799 ATTGTGAAGAAAGATGGTGGTGG + Intronic
908598061 1:65709560-65709582 ATTTTGAAGAACACTGGAGAAGG + Intergenic
909686116 1:78350935-78350957 ATTGAGAAGAACAAAGCAGAAGG - Intronic
909818307 1:80025449-80025471 ATTGTTAAGAACTGTGATGTTGG + Intergenic
910261974 1:85302110-85302132 AGTGTGTATGACAATGATGACGG - Intergenic
910638256 1:89432722-89432744 ATTTTGAAAAACACTGATAAAGG + Intergenic
910731940 1:90407140-90407162 AGGATAAAGAACAATGATGATGG - Intergenic
913280389 1:117179961-117179983 ATGGTTAAGACCAACGATGATGG - Intronic
913367271 1:118053884-118053906 ATTGGGAAGAAGCATGAAGATGG - Intronic
914312027 1:146475194-146475216 ATTTTGACGTACAATTATGATGG + Intergenic
915889496 1:159759254-159759276 ATCGTGAAGAACATTGATGATGG + Intergenic
917551668 1:176038442-176038464 ATTTTCAAAAACAAGGATGAAGG + Intronic
918734879 1:188048095-188048117 CTTGTGAAGAACAAAGAAGTGGG - Intergenic
919003462 1:191864811-191864833 ATGTTGAATAACAATGGTGAAGG - Intergenic
919081963 1:192877876-192877898 ATTGTTTAGAACAGTGAAGAAGG - Intergenic
919145892 1:193634488-193634510 ATTGGGAAGAAAAATCATTAGGG - Intergenic
919185286 1:194139058-194139080 ATTAAGAAGAATAATGATTATGG + Intergenic
919297261 1:195718770-195718792 CTAGTGATTAACAATGATGATGG - Intergenic
921797445 1:219363048-219363070 ATTTTTAAAAACAATGAAGACGG - Intergenic
921847752 1:219902187-219902209 TTTGTGAAGAAAAAAAATGAAGG + Intronic
922682412 1:227611546-227611568 CTTGAGAAGAACACAGATGAAGG - Intronic
923150552 1:231229431-231229453 ATTGGGGAAAACAATTATGATGG + Intronic
923202952 1:231729902-231729924 ATTTTAAAAAATAATGATGATGG + Intronic
1063750920 10:8946236-8946258 ATTTTAAAAAACAATGATAATGG + Intergenic
1063891432 10:10633101-10633123 ATCATGAATAATAATGATGATGG - Intergenic
1065002296 10:21348050-21348072 CAGGTGAAGAAAAATGATGATGG - Intergenic
1065486177 10:26238331-26238353 GATGTGAGGCACAATGATGAGGG - Intronic
1065539558 10:26748652-26748674 GTTATAAAGAAGAATGATGATGG - Exonic
1066322297 10:34315756-34315778 ATAATGAAGAAACATGATGAGGG + Intronic
1068362148 10:55990503-55990525 ATTGTTGATGACAATGATGATGG - Intergenic
1068466985 10:57406730-57406752 ATTGTGAAAAACAATGTGAATGG + Intergenic
1068824370 10:61417911-61417933 ATTGTCAAAAACAACGATCAGGG + Intronic
1069194256 10:65528694-65528716 ATTCTGAAGTAAATTGATGATGG + Intergenic
1069278905 10:66628660-66628682 CTTGTGAAGAAGCATGAAGAAGG + Intronic
1069431992 10:68345582-68345604 ATTTTGAAAAACAATGGGGAAGG + Exonic
1070354457 10:75626290-75626312 ATTGTGGAGAGGAATGATGTCGG - Intronic
1070719170 10:78744647-78744669 AGTGTGTAGAACATTAATGAGGG + Intergenic
1072174532 10:92905220-92905242 ATATTGAAGAACAAAGTTGAAGG - Intronic
1073927580 10:108534629-108534651 ATTGTAAAGACCATTGATGCTGG + Intergenic
1073985188 10:109200154-109200176 AAAGTGAAGAACAAAGAGGAAGG + Intergenic
1074428312 10:113371475-113371497 ATTGTGAAGAAGAAAGAATAGGG - Intergenic
1075259576 10:120950758-120950780 ATAGTGAAGAACAAAGAAGAGGG - Intergenic
1075889159 10:125930636-125930658 ACACTGAAGAACAATGAAGATGG - Intronic
1078160423 11:8835347-8835369 ATTCTCAAGAACAATAGTGATGG + Intronic
1079362581 11:19781509-19781531 ATTGAGAATAATGATGATGAGGG + Intronic
1081141886 11:39511566-39511588 ATTGTGAAAAACCAAGAGGATGG - Intergenic
1081164695 11:39793186-39793208 ATTGTAAAAAATAATTATGAAGG - Intergenic
1082802245 11:57423776-57423798 AATGTGAAAAGCAAGGATGATGG - Intronic
1085858348 11:80202171-80202193 ATTGTGAAGAAGAAATATGAAGG + Intergenic
1086327653 11:85720318-85720340 ATTATCAAGAACATTTATGAAGG - Intronic
1090424237 11:126595924-126595946 ATTGTAATAAACAATGATTAAGG + Intronic
1090935481 11:131338076-131338098 AATGTGAAGAAAAAAGAAGAGGG - Intergenic
1091050514 11:132365108-132365130 ATTTTCTAGGACAATGATGATGG - Intergenic
1092305334 12:7294817-7294839 ATTGTAAGGAACAGTGTTGAGGG + Intergenic
1093081460 12:14816502-14816524 ACTGTGAAGAAGAAAGATAAAGG - Intronic
1093480225 12:19596774-19596796 ATTGATAAGAATAATGAAGAGGG + Intronic
1093646573 12:21591883-21591905 TTTTTGAAGAACAATGTTGCTGG - Intronic
1095380346 12:41583462-41583484 ATTTTTATGAACAATGATAAAGG - Intergenic
1097515479 12:60599707-60599729 ACTGTGATAAAAAATGATGATGG + Intergenic
1097567158 12:61285768-61285790 ATTGTGAAGAATAATTTTGCTGG - Intergenic
1098597161 12:72287188-72287210 ATGAGGAAGAACAAGGATGATGG - Intronic
1098935242 12:76471693-76471715 ATTGTGAAGAGCCTTGAAGATGG - Intronic
1099228646 12:79997938-79997960 ATTGCAAAGAAATATGATGAAGG + Intergenic
1099454595 12:82848540-82848562 ACTGTGAAGAACACTGAAAATGG - Intronic
1099826743 12:87785329-87785351 ACTGTGAAGCACAAAGAAGAGGG - Intergenic
1100459366 12:94783729-94783751 TATGTGAAGAACAATGCTGAAGG + Intergenic
1100685003 12:96978102-96978124 ATTGTGAACCACAAAGATGAAGG - Intergenic
1101142151 12:101807392-101807414 ATTTTGAATAAGAATGGTGATGG - Intronic
1101231827 12:102749171-102749193 ATTGTGAAGAATAAAGATAATGG - Intergenic
1101267310 12:103102543-103102565 ATTCTGAAGAGCGATGAGGAAGG - Intergenic
1101398376 12:104367591-104367613 ACTGTGAAGAAAAATTCTGAGGG - Intergenic
1101968374 12:109295982-109296004 AATGGGAGCAACAATGATGAAGG + Intronic
1102844270 12:116161842-116161864 ATAGTGAAGAAGCTTGATGAGGG - Intronic
1104243480 12:127014526-127014548 ATTGTGAAGTGCAATAATTAAGG + Intergenic
1104498893 12:129266092-129266114 CTTGTGAAGGCCACTGATGATGG + Intronic
1104510269 12:129371372-129371394 ATGGTGATGATGAATGATGATGG + Intronic
1104578713 12:129992968-129992990 AGAGTGAAGAACACTGAGGAAGG - Intergenic
1106713278 13:32360956-32360978 ATTGAGAAGACCAAAGATGGAGG + Intronic
1107763622 13:43709559-43709581 AATGTGAAAAACATTCATGAAGG + Intronic
1108364951 13:49701345-49701367 TTTGTGGAGGACAATGATGGAGG + Exonic
1108988969 13:56630750-56630772 ATTGTAAAGACCATTGATGCTGG + Intergenic
1109881694 13:68486825-68486847 ATGGTGAAGGAAAATGGTGAAGG - Intergenic
1110624321 13:77635009-77635031 ATTGTGAAGTACAATAATGGTGG + Intronic
1110822947 13:79937535-79937557 GCTGTGAAGAACAATGTAGAAGG - Intergenic
1112067102 13:95804500-95804522 ATTGTGAAAAAGAATGAAGTTGG + Intronic
1113098831 13:106695409-106695431 TTTGGCAAGAAGAATGATGATGG + Intergenic
1114369691 14:22072660-22072682 AATGTGAATAACAATAATAAAGG - Intergenic
1115197884 14:30821507-30821529 ATCGTGAAGAACATTGATGATGG + Intergenic
1115565167 14:34618861-34618883 ATTATGAAGAAAAATGAGGGAGG - Intronic
1115889759 14:38013164-38013186 ATTGTGATCCACAATGCTGAAGG + Intronic
1116717146 14:48442033-48442055 ATTGGAAAGGACAATGATAATGG + Intergenic
1117123786 14:52597418-52597440 ATTATGAAGAAAAATAGTGAAGG - Intronic
1117170239 14:53086704-53086726 ATTGTAAAGACCATTGATGCTGG + Intronic
1117527152 14:56620307-56620329 ATTATAAAGAACAATGTTGTGGG - Intronic
1117769624 14:59119736-59119758 ACTGTGGAAAAAAATGATGAAGG + Intergenic
1117811043 14:59547407-59547429 CTTTTGAAGAACAAAGGTGAAGG + Intronic
1118123087 14:62867926-62867948 GTTGTGAAGAACAATAAAGCAGG - Intronic
1118794283 14:69126611-69126633 ATTTTGAAGAACAAAGTTGGAGG + Intronic
1121858378 14:97291851-97291873 ATAGTTAATAATAATGATGAGGG + Intergenic
1121934153 14:98001406-98001428 AATGTGAAAAACAATAATCATGG - Intergenic
1125042202 15:35202297-35202319 ATTGAGAAGATCAAGGATGGTGG + Intergenic
1126215815 15:46153676-46153698 ATTGTCAAGACCAAAGGTGATGG + Intergenic
1126895841 15:53256341-53256363 GTTGTCAGGAACCATGATGACGG + Intergenic
1126981776 15:54252426-54252448 ATAGTGCAGAACAATGAAGGTGG + Intronic
1127360692 15:58242476-58242498 AATGAGAAAAAAAATGATGATGG + Intronic
1127405162 15:58636550-58636572 GTTGTGAATAACAATGAGAAGGG + Intronic
1127888553 15:63226599-63226621 AGTGTGAAGAAAAATGACGCTGG - Intronic
1129113740 15:73353406-73353428 GTTTTGGAGATCAATGATGAAGG + Intronic
1129581622 15:76818001-76818023 ATTTTGAAGAACAAAGCTGGTGG + Intronic
1131894904 15:97016550-97016572 ATTGTTAAGTAGAATAATGATGG - Intergenic
1133430465 16:5732805-5732827 TTTGTGAAGAATATTCATGAGGG - Intergenic
1133931351 16:10234903-10234925 GCTGTGAAAAACAATGATGTAGG - Intergenic
1138004849 16:53323619-53323641 ATTGGGAAGAACAATAAAGAAGG - Intronic
1139128969 16:64117424-64117446 ATTGAATATAACAATGATGATGG - Intergenic
1139153615 16:64414569-64414591 AATGTAAAGAAGAATGATAATGG - Intergenic
1140553020 16:75887780-75887802 ATAAAGAAGAAAAATGATGAAGG + Intergenic
1140705146 16:77621343-77621365 ATTGTGAAGAATAAAGTTGGTGG + Intergenic
1141167694 16:81671464-81671486 CTTTGGAAGAAAAATGATGAGGG - Intronic
1142314347 16:89334250-89334272 ATTGTGAAGGCCATTGATGAGGG - Intronic
1142634874 17:1250806-1250828 ATTGTTAAGCATAAGGATGAAGG + Intergenic
1142930719 17:3282022-3282044 ATGGAGAAAAACAATGAAGAGGG - Intergenic
1146167061 17:30598534-30598556 TTTGTGCAGAACAATGAGCAAGG - Intergenic
1150094308 17:62359002-62359024 ATTGTAAAGACCATCGATGATGG + Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1153383277 18:4462137-4462159 GTAGTGAAGAACAAATATGAAGG + Intergenic
1153628899 18:7049916-7049938 AATGTGAAGAACAAAGACTACGG + Intronic
1153719453 18:7887042-7887064 ATTGTGAATCACAATGTTCAAGG - Intronic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1154459865 18:14571493-14571515 AATATTAAGAACAATGATGTAGG - Intergenic
1156208998 18:34918769-34918791 ATTGTGAAAAAAAAAGATGTTGG - Intergenic
1156615488 18:38778725-38778747 ATTGTGAAAAAGAATGAGCATGG + Intergenic
1158012360 18:52743578-52743600 ATGGTAAAGAACAATAATAAGGG - Intronic
1158787854 18:60738936-60738958 TTTGTGAAGAACCATCATCATGG + Intergenic
1159195388 18:65107549-65107571 ATTGTTAAAACCAATGATCACGG - Intergenic
1159402064 18:67951567-67951589 TTTGTGAGGAAAAATGGTGAGGG + Intergenic
1159621212 18:70640891-70640913 AATTTGAAGAAAAAAGATGAAGG - Intronic
1159663688 18:71130908-71130930 ATTCTTAAGAAGAATGATGTTGG - Intergenic
1159901262 18:74048795-74048817 ATTCTGAAGAACAGTGTGGAGGG - Intergenic
1160349854 18:78167869-78167891 GGTGTGAATAATAATGATGATGG + Intergenic
1162521567 19:11183397-11183419 ACTGTGAAGAATTAAGATGAAGG + Intronic
1168392141 19:56018281-56018303 ATTTTAAAGAACAATCATTAGGG - Intronic
926981171 2:18571137-18571159 AATGTTCAGAACAGTGATGAGGG - Intronic
927611648 2:24547684-24547706 ATTGTTAAAAAAAAGGATGAGGG + Intronic
928215071 2:29354555-29354577 ATTGAGAAGAAGGATGAAGAAGG - Intronic
928769531 2:34690075-34690097 ATTTTGAAGAAAAATTCTGATGG + Intergenic
930743005 2:54852118-54852140 ATTATGAAGAACAAAGATCTGGG - Intronic
931572582 2:63684378-63684400 ATCATGAAGAACATTGATGATGG + Intronic
932297767 2:70641308-70641330 ATACGGAAGAACAAGGATGATGG + Intronic
933061225 2:77739375-77739397 GTTCTGAAGAACATTTATGAAGG + Intergenic
933076179 2:77929976-77929998 ATTGTGAAGAGCGCAGATGAGGG - Intergenic
933198777 2:79423865-79423887 GTTCTGAAGAACAATAATAAAGG - Intronic
934096160 2:88607077-88607099 ATTCTGAATAACAATAAGGAAGG + Intronic
934551254 2:95263742-95263764 AGTGTGATGAAAAAGGATGAAGG - Intergenic
935690980 2:105732343-105732365 TTTGTGTAGAACAATGACAATGG + Intergenic
936501435 2:113069963-113069985 ACTGTGCAGGAGAATGATGAAGG + Intronic
936548565 2:113414292-113414314 ATAGGGAAGAAAAATGAGGAAGG - Intergenic
936632557 2:114219448-114219470 ATTGTAAAGAGGAATCATGAAGG + Intergenic
936705596 2:115069001-115069023 CCTGACAAGAACAATGATGAAGG - Intronic
937180690 2:119993516-119993538 ATTGTGAAGAACATTGATGATGG - Intergenic
937775502 2:125770828-125770850 AATGTGAAAAACAAGGATGAAGG + Intergenic
938222710 2:129585152-129585174 AATGAGAAGAACAAAGTTGAAGG + Intergenic
939144361 2:138394977-138394999 ATGGTAAAGAACAATGTTGGAGG + Intergenic
941103878 2:161330429-161330451 AATGTGTAAAACAATGTTGAAGG - Intronic
941166451 2:162088015-162088037 TTTGTGAATAACAATAATCAAGG + Intergenic
942040351 2:172055493-172055515 ATTGTGATAAACAAAGTTGAGGG + Intronic
942629908 2:177944399-177944421 GTTGCAAAGATCAATGATGAAGG - Intronic
942872856 2:180756325-180756347 ATTGTGGAGAAAAATTATTAGGG - Intergenic
942935060 2:181545717-181545739 ATTGGGAAGAAGAAGCATGATGG - Intronic
943459931 2:188159969-188159991 CTTGGGAAGAACAAAGATGTGGG - Intergenic
943504882 2:188742361-188742383 ATTGTGAAGAAAAATGTTATTGG - Intronic
944063147 2:195590856-195590878 ATTGTGTAGGACAAAGATCAAGG + Intronic
944066876 2:195628628-195628650 ACTTTGAAGAAAAAGGATGAGGG + Intronic
944894276 2:204148069-204148091 ATTGTGAAAAACAATATGGAAGG - Intergenic
945076055 2:206040507-206040529 ATCGTAAAGAACATTAATGATGG + Intronic
945576011 2:211529951-211529973 ATCCTGAATAACAATGGTGAGGG - Intronic
945706981 2:213247850-213247872 ATTGTGAAAGACAACTATGAAGG + Intergenic
945982130 2:216321028-216321050 AGAGTGAAGAATAATGATGTTGG + Intronic
947269074 2:228313384-228313406 CTTGGGAATAATAATGATGATGG - Intergenic
1168950450 20:1796552-1796574 ATGGTGAAGAGAAATGATGTGGG - Intergenic
1169649910 20:7855513-7855535 ATTCTGGGGAACAATGAGGATGG - Intergenic
1172211818 20:33204896-33204918 ATGGTGAGTAACAATGATAAGGG + Intergenic
1172233120 20:33350470-33350492 AATGTGAACAAAAATGTTGACGG + Intergenic
1176253121 20:64136061-64136083 TTTGTGAAGCACAAAGCTGAGGG - Intergenic
1176814250 21:13581333-13581355 AGTATTAAGAACAATGATGTAGG + Intergenic
1176900637 21:14437651-14437673 CTTGAGAACAAGAATGATGAAGG + Intergenic
1177098684 21:16872130-16872152 ATTGTGATGATCTGTGATGAGGG - Intergenic
1177769498 21:25498704-25498726 ATTTTGAAGAGCAATGTTGTTGG - Intergenic
1178205946 21:30465461-30465483 ACTGTGAAGTACCATGATTAGGG - Intergenic
1178848464 21:36193105-36193127 ATTGTAAAGAACAGTGTTGAAGG + Intronic
1178967566 21:37136706-37136728 CTAGTGAAGATCATTGATGAAGG + Intronic
1179595613 21:42441354-42441376 ATTGTGAACAAATAAGATGAAGG - Intronic
1179900219 21:44388468-44388490 ATGGAGAAGGACAGTGATGATGG + Intronic
1181450181 22:23014593-23014615 CTAGGGAAGAACACTGATGACGG - Intergenic
951828183 3:26892738-26892760 TTTGTAAAGAACAAAGTTGAAGG + Intergenic
953827134 3:46263415-46263437 ATTATGAATAAGAATGCTGATGG + Intronic
955389605 3:58511383-58511405 ATCATGAAGGACATTGATGATGG + Intronic
955568885 3:60281385-60281407 ATATTGAAGAACAAAGTTGAAGG + Intronic
956585844 3:70863851-70863873 AATGTGAAGACAAATGATTAGGG - Intergenic
957118363 3:76056673-76056695 ATTCTGAGGAACATTTATGATGG + Intronic
957152683 3:76505986-76506008 ATTTTGAAAAGCACTGATGAAGG + Intronic
957192623 3:77029351-77029373 ATGTAGAAGAAAAATGATGAGGG + Intronic
957542891 3:81598371-81598393 ATTGTGAGGAAAAATGAGAAAGG + Intronic
957778717 3:84790287-84790309 ATTCTGAAACACATTGATGATGG + Intergenic
958748310 3:98164286-98164308 TTTATGAAGAACAGTGGTGAAGG - Intergenic
958865059 3:99490903-99490925 ATTGTGAAAAACAGAGAGGAGGG + Intergenic
960430250 3:117560121-117560143 AGTATGAAGAATAATTATGACGG + Intergenic
960460823 3:117932928-117932950 ATTGTGAAGGAAGAGGATGAAGG + Intergenic
962463316 3:135634688-135634710 ATTTTGAAGAAATATTATGAAGG + Intergenic
962625494 3:137221800-137221822 ATTATGAAGAACAAACATGATGG - Intergenic
962937331 3:140092919-140092941 ATGGCCAAGAACAAGGATGAGGG + Intronic
966660914 3:182413554-182413576 ATTGAGAAGAAAAATGCTAAGGG + Intergenic
967076438 3:186007234-186007256 ATTATGAAAAATAATTATGAGGG - Intergenic
967327045 3:188251275-188251297 ATTGCTAACAACAAAGATGATGG - Intronic
970122362 4:12770819-12770841 TGGGTGAAGAAAAATGATGAGGG + Intergenic
971671945 4:29572072-29572094 ATAATGAAGAATAATAATGAGGG + Intergenic
971894032 4:32566775-32566797 ATGTTGAAGGAAAATGATGATGG + Intergenic
972685811 4:41351500-41351522 ATTGTAAAGACCATTGATGCTGG + Intergenic
972868466 4:43265200-43265222 ATTATTAATAATAATGATGATGG + Intergenic
974281391 4:59798941-59798963 TCTGTGAAGAATGATGATGATGG + Intergenic
974574231 4:63697368-63697390 ATTGTGAACCACTTTGATGAAGG + Intergenic
974675559 4:65083971-65083993 ATTTTAAAGAATAATTATGACGG - Intergenic
974728744 4:65833942-65833964 ATCTTGAAGAACAACAATGAAGG + Intergenic
974844314 4:67332737-67332759 ATTGGGAAGAATAATAAAGAAGG + Intergenic
975631126 4:76403691-76403713 AATGTGGAGAACAATGGTGGTGG + Intronic
975987071 4:80210525-80210547 ATTGGGAAGAAAAATAATCATGG + Intergenic
976295542 4:83467702-83467724 AATGTGAAGATCAATGAAGTAGG - Intronic
976366110 4:84234139-84234161 ATGGAGAATAAAAATGATGAAGG + Intergenic
976546527 4:86342088-86342110 ATTGACAAGAACACTGATGCAGG + Intronic
976736919 4:88319546-88319568 ATTTTGAAGGACATTGTTGAAGG + Intergenic
976992147 4:91380835-91380857 ATTGTAAAGAACATTCATGCTGG - Intronic
977745745 4:100545005-100545027 ATTGAGAAGACCAAAGATAAAGG + Intronic
978235512 4:106453298-106453320 ATTTTGAAGAACAGGGGTGATGG + Intergenic
978611854 4:110550337-110550359 AGTGTGACTCACAATGATGAAGG - Intronic
979345588 4:119583161-119583183 CTAGTGAAGATCATTGATGAAGG - Intronic
982150634 4:152452486-152452508 ATTGTGCTCAACAATGAAGATGG - Intronic
982250384 4:153400207-153400229 ATGGTGATGAAAAATGATAAAGG - Intronic
983730992 4:170993066-170993088 ACTGTAAAGAAAAATAATGAAGG - Intergenic
1202767756 4_GL000008v2_random:165212-165234 ATTGTGGGGAATAATAATGAAGG - Intergenic
986768008 5:10945649-10945671 ATAGTGAATTTCAATGATGAAGG - Intergenic
987093526 5:14528299-14528321 ATCTTGAAGAACAATGAAGCTGG + Intronic
987725868 5:21699093-21699115 TTTGTGAAGAACAAGGAAGAGGG - Intergenic
988115382 5:26881518-26881540 ATTGTGACCTACAACGATGAAGG - Exonic
988330489 5:29832539-29832561 ATTGCTAAGATCATTGATGAAGG - Intergenic
988554169 5:32222004-32222026 ATTGTGAAGAACAATGATGATGG + Intergenic
988641670 5:33047391-33047413 ATTGTGAAGAAATATTGTGAAGG - Intergenic
989165501 5:38430068-38430090 ATCGTGAAGAACATTGATGATGG - Intronic
989299958 5:39879105-39879127 AATATAAAGAACAATTATGAAGG + Intergenic
989342463 5:40391314-40391336 ATTATGAATTACAACGATGATGG - Intergenic
991193607 5:63905594-63905616 ATTGTTTAAAACAATGATCAAGG + Intergenic
991201954 5:64005104-64005126 AGTGTGAAAAAAAATGCTGAAGG + Intergenic
992866967 5:80967512-80967534 ATTGTGAAGACCTGTGGTGATGG + Intronic
995041994 5:107599276-107599298 GTTGTAAAGAATAATGAGGAAGG + Intronic
995043603 5:107618871-107618893 AATGTGAAGAGGAATGATTATGG - Intronic
996406003 5:123104034-123104056 TTTCTGAAGAAAAATAATGAAGG - Intronic
996566732 5:124887509-124887531 ATTGTGAAGAAATTTGATAATGG - Intergenic
996769113 5:127066952-127066974 ATTGTCAAGGAGACTGATGAGGG + Intronic
996857053 5:128020000-128020022 ATTGAGAATAACACTGAAGATGG - Intergenic
998430835 5:142068631-142068653 ATTGTGAAAAACATGGTTGAGGG + Intergenic
998517002 5:142765425-142765447 ATTTTAAAAAATAATGATGATGG - Intergenic
998543393 5:143004641-143004663 ATTGTGCTGAACAGAGATGAAGG - Intronic
998950771 5:147391246-147391268 GTCGTGAAGAACAAGGCTGAGGG + Exonic
1004665320 6:17743981-17744003 ATACTGAAGAAAAATGAAGAGGG + Intergenic
1004883962 6:20034413-20034435 TTTGTGAAGAACAAAGAGGGGGG - Intergenic
1005772037 6:29083117-29083139 AATGTGAAGAGAAATGATGTGGG - Intergenic
1006508739 6:34509507-34509529 ATTGAGAAGAACAAAGCTGGAGG - Intronic
1007036826 6:38682011-38682033 TTTGTGAAGAAACCTGATGATGG - Exonic
1007695125 6:43727108-43727130 AATGTGAACAAGAAAGATGAAGG - Intergenic
1008859489 6:56132411-56132433 ATTATAAAGAATAATGAGGAAGG + Intronic
1009701904 6:67195383-67195405 ATTTTGAAGAACAAAGCTGAAGG + Intergenic
1010380910 6:75223985-75224007 ATTCTAAAGGACAATGAAGATGG + Intergenic
1010814387 6:80339851-80339873 ATTGAGAATAGCAATGATAAGGG - Intronic
1011352965 6:86443517-86443539 AGTATGAAGAACAGTGATAAAGG - Intergenic
1011689477 6:89853171-89853193 CCTCTTAAGAACAATGATGAAGG + Exonic
1012060255 6:94469307-94469329 ATTTTGGAGAACACTGCTGAGGG - Intergenic
1013618183 6:111864267-111864289 AGTGTGAAGAACATAGATGTTGG + Intronic
1013899317 6:115133956-115133978 CTTGTCAAGGAGAATGATGATGG - Intergenic
1014750531 6:125250620-125250642 ATTGGGAAAAACAATGAGCAGGG - Intronic
1016110359 6:140216055-140216077 ATTGTAAAAAACAATGTTGGTGG - Intergenic
1016177079 6:141093549-141093571 AAAGAGAAGAACAAAGATGAAGG - Intergenic
1017086918 6:150721748-150721770 TTTGTGAGGAACAATGATTGGGG + Intronic
1017582392 6:155880394-155880416 ATGATGTAGGACAATGATGATGG - Intergenic
1019349403 7:546891-546913 ATTGTCAGGAACGATGCTGAGGG - Intergenic
1019878742 7:3839775-3839797 ATTGTGAATAGCAATTATGATGG + Intronic
1020207156 7:6127708-6127730 ATTGTGAAGAATAAAGTGGAAGG - Intronic
1020661893 7:10993626-10993648 ATTCTGAAGAAAAATGAAGTAGG + Intronic
1021032464 7:15754792-15754814 ATTTTGAAGAACAATGCACACGG + Intergenic
1021943756 7:25705062-25705084 ATTTTAAGGAACGATGATGAAGG + Intergenic
1022252645 7:28623954-28623976 TATGATAAGAACAATGATGATGG + Intronic
1022355318 7:29609249-29609271 AGAGTGAAGAACAATAAGGACGG + Intergenic
1022782713 7:33602350-33602372 TTTGGGAAGAACAATGTTGGTGG - Intronic
1023510446 7:40946691-40946713 ATTTTGAAGAACAATTTTGCTGG + Intergenic
1027516244 7:79145995-79146017 ATTGGGAATAACAAAAATGAGGG - Intronic
1027675142 7:81147724-81147746 ATGGTGAGCAACAATGATGAAGG - Intergenic
1028311749 7:89347013-89347035 ATTGTGAAGCATAATGATTAAGG - Intergenic
1028399755 7:90412378-90412400 ATTGTGAAGAAAAATACCGATGG + Intronic
1030352399 7:108504674-108504696 ATTGAGAAGAACAAGGTTGGAGG + Intronic
1030999608 7:116399258-116399280 ATTCTGAAGAATAGTGATGCTGG + Intronic
1031457404 7:121999392-121999414 ATTGTGAGGAACTTTGGTGATGG - Intronic
1031528202 7:122847060-122847082 AATGTGAAGAATAATGGAGAAGG - Intronic
1031860170 7:126970335-126970357 TTAGTGAAGAGCATTGATGAAGG - Intronic
1032359559 7:131242664-131242686 ATCGTGAAGAACATTGATGATGG + Intronic
1032612374 7:133429094-133429116 GGTTGGAAGAACAATGATGAAGG + Intronic
1033502238 7:141963535-141963557 ATAGAGATGCACAATGATGATGG - Intronic
1033580084 7:142724967-142724989 ATTTTGAAGTAGAAGGATGAAGG + Intergenic
1036731136 8:11265929-11265951 TTTTTGAAGAAAAATGAGGAGGG - Intergenic
1037453439 8:19039930-19039952 ACTGTGAAGAAAAATGAAGCAGG + Intronic
1039140933 8:34387266-34387288 GTGGAGAAGAACAAAGATGAAGG + Intergenic
1040654060 8:49484057-49484079 ATCCTGAAGAACAGTGATGGGGG + Intergenic
1040732356 8:50463903-50463925 CTAGTGAAGATAAATGATGAAGG - Intronic
1041298224 8:56383918-56383940 ATTATAAAAAACAATGATGACGG + Intergenic
1041597874 8:59678179-59678201 AGTGTGCAGAACAAAGATCAAGG + Intergenic
1043795978 8:84540224-84540246 ATATTGAAGAGCAATCATGATGG + Intronic
1044363279 8:91313417-91313439 CTTGAGAAGAACAAAGCTGAAGG - Intronic
1044446207 8:92279881-92279903 ATTGTGAAAAACAACCAGGACGG - Intergenic
1044571323 8:93722382-93722404 TATGTGAAGAACAATTAAGATGG - Intronic
1044789811 8:95835876-95835898 ATTGGGTAGAACCATGAAGAGGG + Intergenic
1044893353 8:96861332-96861354 ATTGGGAAGAACAGTGAAAAGGG + Intronic
1044939296 8:97324317-97324339 ATTTAGAAGAAAAATGATGGTGG - Intergenic
1045055847 8:98367767-98367789 AATGGGAAGCACATTGATGAAGG + Intergenic
1046115049 8:109775025-109775047 ATTGTAAAGAACATTGAAGCTGG - Intergenic
1046147173 8:110175869-110175891 CTAGTAAAGAACATTGATGAGGG + Intergenic
1046707308 8:117469302-117469324 ATTGGGAAGAACCATCATGCGGG - Intergenic
1047053607 8:121139769-121139791 ACTGTTACGAACAATGATGGTGG + Intergenic
1047811953 8:128420396-128420418 TTTGTTAAGAACAATAATTAAGG - Intergenic
1048913380 8:139158308-139158330 GTTGTCAAGAACAAGGATGAAGG - Intergenic
1049904431 9:202880-202902 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1050642069 9:7678877-7678899 AATGTTAACAACAATGATGACGG + Intergenic
1050971964 9:11889088-11889110 TTTGTAAAGAATGATGATGATGG + Intergenic
1051568371 9:18526527-18526549 ATTGTAAAGACCATTGATGCTGG - Intronic
1052601573 9:30638793-30638815 AGTTTGAAGAACAAAGTTGAAGG - Intergenic
1053512026 9:38695755-38695777 AGTTTGAAGAACACTGTTGAAGG + Intergenic
1053727003 9:41014454-41014476 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1054715642 9:68555611-68555633 ATTGAAAGGAACAATGCTGATGG + Intergenic
1054754232 9:68940971-68940993 ACTGTAAAGAAAAATCATGAGGG - Intronic
1055247908 9:74269097-74269119 GTTGTGAAGATCAAAGATGATGG - Intergenic
1055710036 9:79050688-79050710 ATTATCAAAAACAATGAGGATGG - Intergenic
1056509142 9:87286141-87286163 ATTGTAAAGAGTAATTATGATGG - Intergenic
1056835797 9:89954160-89954182 ATTGTCAAGAAAAATAAGGAGGG - Intergenic
1057419275 9:94897131-94897153 ATTTTGAAGAGTAATGATGAGGG + Intronic
1057726142 9:97569713-97569735 GTTGTGAAGATCAAAGATGATGG - Intronic
1058059775 9:100482746-100482768 ATTGTGAATAACAGGAATGAGGG - Intronic
1058353054 9:104049730-104049752 TTTATGAAGAAAAATGATCATGG - Intergenic
1058745347 9:107985224-107985246 ATTGTTAAGAACAAAATTGATGG + Intergenic
1059510184 9:114837897-114837919 TTGGTGAAGAAGAAAGATGAGGG - Intergenic
1188823996 X:34807800-34807822 AATGTGGAGAACAATAATGATGG + Intergenic
1189912677 X:45826964-45826986 ACTTTGAACAACAATGATGTAGG - Intergenic
1190180761 X:48190355-48190377 ATTGTTGAGAACATTGATTAAGG - Intronic
1190183467 X:48214396-48214418 ATTGTTGAGAACATTGATTAAGG + Intronic
1190658125 X:52630162-52630184 ATTGTTGAGAACATTGATTAAGG + Intergenic
1190660330 X:52648483-52648505 ATTGTTGAGAACATTGATTAAGG - Intronic
1193690768 X:84639458-84639480 TCTGTGAAGAATGATGATGATGG - Intergenic
1193738801 X:85193228-85193250 ATGGGGAGGAAAAATGATGATGG + Intergenic
1194094303 X:89618632-89618654 ATTGTAAAGACCATTGATGCTGG - Intergenic
1194171958 X:90597774-90597796 ATTGTGAAGAAAATGGATGGTGG - Intergenic
1194773340 X:97931806-97931828 ATGGTGAATATAAATGATGATGG - Intergenic
1195620541 X:106950273-106950295 TTGGTGGAGAACAATTATGAGGG - Intronic
1196039065 X:111181961-111181983 TTTGTGAAGAACAATGTTTATGG + Intronic
1196074687 X:111562743-111562765 AGTGTAAATTACAATGATGAAGG - Intergenic
1196934860 X:120719536-120719558 GCTCTGAAGAACAATGGTGAAGG + Intergenic
1197294603 X:124702995-124703017 ATCGTGAATAATAATTATGATGG + Intronic
1198232875 X:134709274-134709296 ATTGTGAAGAAGAGTAGTGAAGG + Intronic
1198740263 X:139834824-139834846 ATTGTGAATAACCAGGAGGAGGG - Intronic
1199429592 X:147744002-147744024 ATTTTAAAGAATAATTATGAAGG + Intergenic
1200120703 X:153788984-153789006 TTTGTGAAGAAAGATGCTGAGGG + Intronic
1200446937 Y:3274812-3274834 ATTGTAAAGACCACTGATGCTGG - Intergenic
1200518188 Y:4175523-4175545 ATTGTGAAGAACATGGATGGTGG - Intergenic
1200847163 Y:7842495-7842517 ATTGTAAAGACCATTGATGCTGG - Intergenic
1202020619 Y:20461362-20461384 ATTGTAAAGACCATTGATGCTGG - Intergenic