ID: 988556709

View in Genome Browser
Species Human (GRCh38)
Location 5:32242768-32242790
Sequence GCAGACAGGGATAAATGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988556709_988556713 11 Left 988556709 5:32242768-32242790 CCATAACATTTATCCCTGTCTGC 0: 1
1: 0
2: 0
3: 9
4: 166
Right 988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG 0: 1
1: 0
2: 1
3: 3
4: 61
988556709_988556714 19 Left 988556709 5:32242768-32242790 CCATAACATTTATCCCTGTCTGC 0: 1
1: 0
2: 0
3: 9
4: 166
Right 988556714 5:32242810-32242832 GAGACGTGTAGCAGGATGTCTGG 0: 1
1: 0
2: 0
3: 16
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988556709 Original CRISPR GCAGACAGGGATAAATGTTA TGG (reversed) Intronic
902856794 1:19212368-19212390 GCAGACATTGATGAATGGTATGG + Intergenic
903254697 1:22087485-22087507 GAAGATAGGGAGCAATGTTAGGG + Intronic
906857613 1:49325346-49325368 GCAGACATGCAAAAATGTAATGG - Intronic
911584517 1:99675231-99675253 ATAGTCAGGGATAAATGTTAAGG + Intronic
911872886 1:103121491-103121513 TCAGCCAGGGATAAATGATTTGG - Intergenic
913182515 1:116335837-116335859 GCAAACAGGGAAAAACATTAAGG + Intergenic
916209306 1:162346953-162346975 ACAGAGATGGAAAAATGTTAAGG - Intronic
921010699 1:211138165-211138187 GCAGACAGGGATAGGTTCTAAGG + Intergenic
923635116 1:235687789-235687811 GAAGACAGGGAAACATGTTGAGG - Intronic
923978316 1:239290384-239290406 GCAAACAGGGATATAAGTAAAGG - Intergenic
1065203293 10:23334634-23334656 GCAGAGTGGGATAACTGTGATGG - Intronic
1066363691 10:34755841-34755863 CAAGACAGGCATTAATGTTAAGG + Intronic
1070696486 10:78567618-78567640 GCAGACAAGAATAAAAGGTAAGG + Intergenic
1073200107 10:101728339-101728361 TCAGACAGCGGTAAATGCTATGG + Intergenic
1074090799 10:110252590-110252612 TCAGACAGATATAAATGTTAAGG - Intronic
1077816253 11:5688500-5688522 TCAGTCAGGGATCCATGTTATGG + Intronic
1078754836 11:14199515-14199537 GGAGACAGGGAGAAAAGTTTAGG - Intronic
1079481746 11:20888518-20888540 GTAAACAGAGATAAAGGTTATGG + Intronic
1080717053 11:34813334-34813356 GGAGAAAGAGATAAATGTTCAGG + Intergenic
1085756972 11:79209777-79209799 CCACACAGGGAGAAATGCTAAGG - Intronic
1086848352 11:91779484-91779506 GCAGAAGGTGATAAATGCTATGG - Intergenic
1087176087 11:95097175-95097197 TTAGACAGTGATAAGTGTTAAGG + Intronic
1090840684 11:130485780-130485802 GCAGACAGGAATACCTGTCATGG + Intergenic
1091673349 12:2468334-2468356 GGAGGCAGTGATAAATGTTAGGG + Intronic
1096692118 12:53327792-53327814 GCAGAAAGGGGTACATGTCAAGG + Exonic
1098094219 12:66937290-66937312 TCAGTCAGTGATAAATGTCATGG - Intergenic
1099024026 12:77443239-77443261 TAAGACAGGCATAAATGTGAAGG + Intergenic
1099222518 12:79932485-79932507 GCAGATATGGAAAAATGTTATGG + Intronic
1099490046 12:83277214-83277236 GCAGAAATGGATATATGTAATGG - Intergenic
1100906944 12:99312176-99312198 GCACAAAGGGCTATATGTTAGGG + Intronic
1102552477 12:113701922-113701944 GCAGACAAGCAGAAATGTGAGGG + Intergenic
1111399727 13:87718970-87718992 TCAGAAAGGTAAAAATGTTATGG + Intergenic
1116936443 14:50745317-50745339 CCAGACATTGATAAATGTTCTGG + Intronic
1117157891 14:52958855-52958877 GAAGAAAGGAATAAATGCTAAGG + Intergenic
1117232969 14:53741128-53741150 GCTAACAGTGAGAAATGTTAAGG + Intergenic
1118299937 14:64606251-64606273 GCAGATAGGGAAAAAGGTAAAGG + Intergenic
1119019345 14:71094186-71094208 GCAGACAGGCATACAAATTATGG + Intronic
1120801335 14:88691841-88691863 GCATAAAAGGATGAATGTTAAGG - Intronic
1121023460 14:90597174-90597196 TGAACCAGGGATAAATGTTAGGG + Intronic
1123894199 15:24811938-24811960 GCAGACAGGGATAAATCAAAAGG + Intergenic
1124517050 15:30375411-30375433 TCATTCAGGGATAAATGCTAAGG + Intronic
1124725868 15:32155306-32155328 TCATTCAGGGATAAATGCTAAGG - Intronic
1125418261 15:39475921-39475943 GCACACAGAGATATATGTTTTGG + Intergenic
1126220315 15:46205788-46205810 GAAGTCATGGATAAATGTTCTGG - Intergenic
1128541018 15:68533057-68533079 GAAGACAGAGATTAATGTTCAGG - Intergenic
1129805558 15:78454027-78454049 ACAGACAGTGACAAATGTTGGGG + Intronic
1130401562 15:83559982-83560004 GCTGACTGGGAAACATGTTAAGG - Intronic
1130975733 15:88772767-88772789 GCAGACAGAGAGAAATGCAAGGG + Intergenic
1131209745 15:90484388-90484410 GCAGCCAGGGATAATAATTAAGG - Intronic
1134012120 16:10862064-10862086 GCAGATAAGTAAAAATGTTAAGG - Intergenic
1135087209 16:19484961-19484983 ACAGAAAAGGATATATGTTAGGG + Intronic
1135143618 16:19942557-19942579 GCACATAAGGATAAATGTTGAGG - Intergenic
1135355749 16:21767672-21767694 TCAGATAGTGATAAATATTATGG + Intergenic
1135454239 16:22583818-22583840 TCAGATAGTGATAAATATTATGG + Intergenic
1139643708 16:68311775-68311797 ACAGACCGGGATAAAAGTTGGGG - Intronic
1141114682 16:81298321-81298343 GCAGACAATGCCAAATGTTAGGG - Intergenic
1141870108 16:86779381-86779403 TCAGACTGTGTTAAATGTTATGG - Intergenic
1149765119 17:59269525-59269547 CCAGCCAGGAATAAATGTTTAGG - Intronic
1153433754 18:5047278-5047300 GCAGACTAAGATAGATGTTATGG - Intergenic
1153504373 18:5780497-5780519 GCAGACAGGAAAACATGTAATGG + Intergenic
1158068444 18:53441428-53441450 GCAGAGAGAGATCAATGTTCTGG + Intronic
1159023286 18:63160702-63160724 GGAGACAGGGAGGAATGTGATGG - Intronic
1159167495 18:64721835-64721857 GGAGACAGGCATAAAAGTTGTGG - Intergenic
1161346013 19:3769062-3769084 TCAGACAGTGATAAGTGATAGGG - Intergenic
1161645921 19:5453403-5453425 GCAGAGAGGGACAAATGTAGCGG - Intergenic
1164908484 19:31986600-31986622 GCAAACACGCATGAATGTTAAGG + Intergenic
1165359380 19:35326596-35326618 CCAGACAGGGATAAAAGTCCAGG + Intronic
1167856310 19:52244160-52244182 GACGACATGGATAAATCTTAAGG + Intergenic
1168118308 19:54238485-54238507 GAAGAGAGGGATCAATGTTGAGG - Intronic
927767564 2:25826429-25826451 GCAGACACTGATGAATTTTAAGG - Intronic
928841871 2:35617351-35617373 GAAGAAATGGATAAATGTTTAGG - Intergenic
931088977 2:58865336-58865358 GAAGATAGGGAGAAATATTATGG - Intergenic
932679892 2:73815987-73816009 GCAGTCAGGGAAAAAAGTCAAGG + Exonic
936051505 2:109227541-109227563 GCAGACAGGGATGAAGGGCAGGG - Intronic
936952103 2:117988179-117988201 ACACACAGGGTTAAATATTAAGG + Intronic
938184653 2:129219114-129219136 GGAGATAGGTATAAAAGTTATGG + Intergenic
941377643 2:164751219-164751241 TCAGATAGTGATAAATGTGATGG - Intronic
942191425 2:173474346-173474368 TCAGAGAGTGATAGATGTTACGG + Intergenic
1168813450 20:721112-721134 GCTGACAGGGATGAGTGCTAAGG - Intergenic
1169863215 20:10173169-10173191 GCAGACAGGAATCAAGGTTTTGG + Intergenic
1169869211 20:10233412-10233434 TGTGACAAGGATAAATGTTACGG - Intronic
1170885684 20:20338063-20338085 GCAGGCAGTGATAAATATCATGG - Intronic
1171350928 20:24502488-24502510 ACAGACAGGAATGAATGTCAGGG + Intronic
1172701256 20:36854940-36854962 ACAGACAGGGATATACGTTTGGG + Intronic
1173683555 20:44906245-44906267 GCAGACAGGGATGATTGCAAAGG - Intronic
1173861916 20:46289330-46289352 TCAGATAGTGATAAGTGTTATGG - Intronic
1174494375 20:50930022-50930044 GCAGACAGGGATCAAGGTTGGGG + Intronic
1182923404 22:34100988-34101010 GCAGACACTGATAGATGTCATGG + Intergenic
1185179960 22:49353691-49353713 GCAGACAGTGAAAAATTCTAAGG - Intergenic
951412447 3:22381400-22381422 GCAGACAGGTGGAAATGCTATGG - Intergenic
951770448 3:26250308-26250330 GGAGGCAGGGATTTATGTTAAGG - Intergenic
952691514 3:36211821-36211843 GGTGACAGGGGTAAATGTTGAGG - Intergenic
953183068 3:40614598-40614620 GCAGACCTGGAGAGATGTTAGGG - Intergenic
953972131 3:47355895-47355917 GCAGACAGGGCTAAAGGATGGGG + Intergenic
957005243 3:74937835-74937857 GCAAAAAGAAATAAATGTTATGG - Intergenic
957602384 3:82354510-82354532 ACAGACAGGGCCAAGTGTTATGG + Intergenic
958652114 3:96949993-96950015 GCACAGAAGGATAAATTTTAAGG - Intronic
959302014 3:104614827-104614849 GCAGGCAGGAATAAATATTCAGG - Intergenic
961948968 3:130726557-130726579 ACAGAAAGGGATAAATGGGATGG + Intronic
962916731 3:139911321-139911343 GCAGAGAGGGAGACATGCTATGG + Intergenic
967004312 3:185369169-185369191 TTAGACAGTGATAAATGTTAAGG + Intronic
968606862 4:1539663-1539685 TCTGACAGGGACAAATGTGACGG + Intergenic
970483998 4:16506167-16506189 GTAGACAGGGTTAAAAGATATGG + Intronic
970954758 4:21797112-21797134 GCAGACAGGCATAGATGGGACGG - Intronic
972690789 4:41395859-41395881 TCAGACAGTGATAAGTGTCATGG + Intronic
973576158 4:52291362-52291384 GCACAGAGAGATAGATGTTATGG - Intergenic
973798575 4:54452899-54452921 AAAGACAGGAAAAAATGTTAAGG + Intergenic
974306924 4:60154832-60154854 GTTGAAAGGAATAAATGTTAAGG - Intergenic
975091674 4:70411260-70411282 GCAGACAAGGAAAAATATGAGGG + Intergenic
975551035 4:75612719-75612741 GCAAAGAGAGATAATTGTTACGG - Intronic
976826612 4:89267604-89267626 CCAGACAGGAAAGAATGTTAAGG - Intronic
982116152 4:152099900-152099922 GAAGCCAGTGATAAATCTTAGGG - Intergenic
983112649 4:163772259-163772281 GAAGACAGGGAATAATGTAATGG + Intronic
983281857 4:165690697-165690719 TTAGACAGTGATAAATGCTAAGG - Intergenic
985146668 4:186900993-186901015 GAAGCCAGGGATAAATGTTTTGG - Intergenic
986018513 5:3779364-3779386 GCAAAGAGGGGTAAATGTGATGG - Intergenic
987227629 5:15860027-15860049 GCAGACAGTTGTAAATATTAGGG + Intronic
988556709 5:32242768-32242790 GCAGACAGGGATAAATGTTATGG - Intronic
989438975 5:41447707-41447729 GCAGAGAGGGATAGCTGTAATGG - Intronic
993761025 5:91797696-91797718 GCAGACAGGTATCAAAGTTTAGG + Intergenic
998318249 5:141203382-141203404 GCAGACAGTGAAAAATACTAGGG - Intergenic
999679893 5:154047073-154047095 GGAGACAGGGAAAAATGAGAGGG - Intronic
999794230 5:154973401-154973423 GAAGACTGGAATAAATGATAGGG + Intergenic
999870747 5:155747902-155747924 GCAGATAGAGATAAATGGTCAGG - Intergenic
999926040 5:156379214-156379236 TCAGACAGTGATAATTGCTAAGG + Intronic
999957689 5:156720258-156720280 TCAGGCAGGAATAAATATTAGGG + Intronic
1000673691 5:164093698-164093720 GCAGACAGTGACAAATGACAGGG - Intergenic
1001103484 5:168833450-168833472 GCAGCCAGGGATCAATGATGTGG + Intronic
1001373855 5:171235542-171235564 GTAGAAAGGTATAAATGGTAGGG + Intronic
1001465796 5:171964982-171965004 TCAGGCTGGGATATATGTTAAGG + Intronic
1005231410 6:23705689-23705711 GTTGATAGGGATAAAAGTTAAGG + Intergenic
1005950214 6:30626230-30626252 GCTGATAGGGATAAATCTTGAGG + Exonic
1007280135 6:40706097-40706119 GAGGACAGGGACATATGTTAGGG + Intergenic
1008278552 6:49568697-49568719 GCAGTAAGTAATAAATGTTAAGG + Intergenic
1008687355 6:53940575-53940597 GCAAACATGGATAAATCTTGAGG - Intronic
1009816350 6:68740963-68740985 GCATACAGTGATATATGTTTTGG + Intronic
1011204437 6:84876528-84876550 GGCCACAGGGAGAAATGTTATGG - Intergenic
1011750392 6:90449366-90449388 GATGACAGGCATAAATTTTATGG + Intergenic
1012954268 6:105551900-105551922 GCAGACAGGGGAAAAAGTGAGGG + Intergenic
1013935145 6:115585586-115585608 GCAGATATTGATAAATGCTAAGG - Intergenic
1014400347 6:120981341-120981363 GAAGAAAGGGATATAAGTTAAGG + Intergenic
1016031046 6:139338603-139338625 GCAGACAGGGGCAAATTCTAGGG - Intergenic
1022540566 7:31131314-31131336 GGATACAGGGATAATTGCTAAGG + Intergenic
1023087754 7:36589089-36589111 GCAGACAAGGATAAGTGATAAGG - Intronic
1026433857 7:70376120-70376142 GAAGAAAGGGATAAATGAAAAGG + Intronic
1026598555 7:71754281-71754303 GCAGGCAGGGACAAAGGTTTGGG + Intergenic
1028170524 7:87590409-87590431 TCAGACAGTGATAAATATTCAGG + Intronic
1028265701 7:88721562-88721584 GCAGTCAGAGAAAAATGATAAGG - Intergenic
1031107536 7:117563578-117563600 GAAGACAGGTAGAAATGCTATGG + Intronic
1032716664 7:134514594-134514616 GAAGATAGGGATAAATGAGATGG + Intergenic
1033190456 7:139274261-139274283 GCACACAGAGATAGATGTAAAGG + Intronic
1038682122 8:29678601-29678623 CCCGACTGGGGTAAATGTTAAGG + Intergenic
1038795819 8:30708380-30708402 GAAGACAAGGAGAAATGTTTTGG + Intronic
1039023778 8:33235418-33235440 GCAGACAGGGACTAATATCATGG + Intergenic
1040643460 8:49368998-49369020 GGACACAGAGATGAATGTTATGG - Intergenic
1042090620 8:65155184-65155206 ACAAACACTGATAAATGTTATGG - Intergenic
1047986318 8:130238072-130238094 GCCGAAAGGGATAAATGCAATGG + Intronic
1048055343 8:130857499-130857521 CCAGACAGTGAGAAATGCTACGG - Intronic
1048634782 8:136284205-136284227 GGAGACAGAAATAAATGTGATGG - Intergenic
1052328352 9:27241096-27241118 GCAGCCAGAGAGAAAGGTTAGGG + Intergenic
1053537099 9:38937004-38937026 GAAGACATGGATATATGTTCAGG - Intergenic
1054629037 9:67426926-67426948 GAAGACATGGATATATGTTCAGG + Intergenic
1055543656 9:77343192-77343214 GCAGACATGGATAAAAGCTTTGG + Intronic
1056015664 9:82384031-82384053 GCAGACAGAGAGACATATTATGG - Intergenic
1056922805 9:90807062-90807084 GCAAGCAGGGATAAATATCATGG + Intronic
1186387880 X:9128236-9128258 GCAGAAAGGGGAAGATGTTAGGG + Intronic
1187581748 X:20614608-20614630 GCAGACAAGGAAGAAAGTTAAGG - Intergenic
1188083574 X:25875768-25875790 GCAGGCAGGGATGAATGAAATGG - Intergenic
1190205334 X:48398247-48398269 GAAGACAGGGTTAAGTGTTGTGG + Intergenic
1190669489 X:52727227-52727249 GAAGACAGGGTTAAGTGTTGTGG - Intergenic
1190669928 X:52731177-52731199 GAAGACAGGGTTAAGTGTTGTGG + Intergenic
1193551522 X:82898755-82898777 ACAGAAAGGGATAATTGTAAAGG + Intergenic
1197919833 X:131580295-131580317 CCAGCCAGGAAAAAATGTTAAGG + Intergenic
1199268258 X:145852385-145852407 GCAGACTGAGATTAATGGTAGGG - Intergenic
1199412662 X:147542817-147542839 GCAGACGGTGATAAATGCTGTGG + Intergenic
1199909942 X:152274923-152274945 CGAGACAGGGAGAATTGTTATGG + Intronic