ID: 988556710

View in Genome Browser
Species Human (GRCh38)
Location 5:32242781-32242803
Sequence TGAATATATAATGGCAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 246}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988556710_988556716 28 Left 988556710 5:32242781-32242803 CCCTGTCTGCCATTATATATTCA 0: 1
1: 0
2: 2
3: 24
4: 246
Right 988556716 5:32242832-32242854 GAGCACAGTTCAGTGTCTGGAGG No data
988556710_988556713 -2 Left 988556710 5:32242781-32242803 CCCTGTCTGCCATTATATATTCA 0: 1
1: 0
2: 2
3: 24
4: 246
Right 988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG 0: 1
1: 0
2: 1
3: 3
4: 61
988556710_988556714 6 Left 988556710 5:32242781-32242803 CCCTGTCTGCCATTATATATTCA 0: 1
1: 0
2: 2
3: 24
4: 246
Right 988556714 5:32242810-32242832 GAGACGTGTAGCAGGATGTCTGG 0: 1
1: 0
2: 0
3: 16
4: 118
988556710_988556715 25 Left 988556710 5:32242781-32242803 CCCTGTCTGCCATTATATATTCA 0: 1
1: 0
2: 2
3: 24
4: 246
Right 988556715 5:32242829-32242851 CTGGAGCACAGTTCAGTGTCTGG 0: 1
1: 0
2: 1
3: 19
4: 186
988556710_988556717 29 Left 988556710 5:32242781-32242803 CCCTGTCTGCCATTATATATTCA 0: 1
1: 0
2: 2
3: 24
4: 246
Right 988556717 5:32242833-32242855 AGCACAGTTCAGTGTCTGGAGGG 0: 1
1: 0
2: 1
3: 16
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988556710 Original CRISPR TGAATATATAATGGCAGACA GGG (reversed) Intronic
900711370 1:4116666-4116688 TGAGAAGATAAAGGCAGACATGG - Intergenic
900875013 1:5336098-5336120 GGAATGTATAATGAGAGACAGGG - Intergenic
903730124 1:25487446-25487468 TGAATAAATTATGGCAGGCCTGG - Intronic
908110036 1:60887685-60887707 TGAAGATACAATGGGAAACAAGG + Intronic
909328397 1:74381884-74381906 TGGAAACATAATGGCAGAGAAGG + Intronic
910122636 1:83807478-83807500 TTAATGCATAATGGCTGACAAGG + Intergenic
910960132 1:92752976-92752998 TGAATAAATAAATGCAGAGAAGG + Intronic
911726801 1:101250289-101250311 TGAAGATATAAAAGCACACAAGG + Intergenic
912027941 1:105202927-105202949 TGAAAATACAAAGGCATACATGG - Intergenic
915161644 1:153924510-153924532 TGAAATTATAATGGAGGACATGG + Intergenic
919510605 1:198459209-198459231 TGAGAATATAATGGCAGAGCTGG + Intergenic
919971602 1:202583791-202583813 TGAATAAATAGCTGCAGACATGG + Exonic
921460511 1:215420815-215420837 TGAATATAGAATGTCAGCCATGG - Intergenic
923308835 1:232714462-232714484 TAAATATAAAAAGACAGACAAGG - Intergenic
1062777731 10:168322-168344 TTAATATATAATGCCAGGCATGG + Intronic
1063866363 10:10369162-10369184 TGGAAACATAATGGTAGACAGGG - Intergenic
1064689522 10:17900959-17900981 TGAATATATAAAAACAGTCAGGG + Intronic
1066207101 10:33200090-33200112 TGAATCTATAATGGCAGAATTGG + Intronic
1066789437 10:39046253-39046275 TCAACATATAATGGAAAACATGG + Intergenic
1068848155 10:61704319-61704341 TGAATACAATATGGCAGAAATGG + Intronic
1068908925 10:62357824-62357846 TCAATATATAATTGCACATATGG - Intergenic
1071311962 10:84351526-84351548 TAAATAAATAAAGCCAGACATGG - Intronic
1071920737 10:90347180-90347202 TGAATATTTATTAACAGACAAGG + Intergenic
1071951782 10:90711562-90711584 TGAATTGATAATGTCAGGCATGG - Intergenic
1073256715 10:102156766-102156788 TCAATATAGATTGGCAGGCAGGG + Intronic
1075140289 10:119827743-119827765 TGTTTATACAATGCCAGACACGG + Exonic
1075605114 10:123799367-123799389 TGAATATATAGTGGCATAGATGG - Intronic
1079886422 11:25994810-25994832 TGAATACATAAAGGCAAACATGG - Intergenic
1080272797 11:30468492-30468514 TGAATATAAAATGGCATTAAGGG + Intronic
1082066248 11:47903038-47903060 TGAACAAATAATGTGAGACATGG + Intergenic
1082985067 11:59161365-59161387 TGAAAATAGCATGGCAGCCAGGG + Intergenic
1086119164 11:83287452-83287474 TGAATATATGATGGTAAACGTGG - Intergenic
1086181614 11:83958185-83958207 TGAATATATATTAGATGACATGG + Intronic
1087680848 11:101217302-101217324 TCAACATATAATGGAAAACATGG - Intergenic
1089112724 11:116069729-116069751 TGAATATATTATGGTTCACAGGG + Intergenic
1090896672 11:130982846-130982868 TGAATAGTTAATGGCACCCATGG + Intergenic
1091004502 11:131940712-131940734 TGAATATCTGATACCAGACATGG + Intronic
1091730685 12:2877801-2877823 TGAAGATACAATGGCAGACAAGG + Intronic
1092909595 12:13135111-13135133 TGGGTATGTAATGACAGACATGG + Intronic
1093114707 12:15195137-15195159 TGAATAAATAACTGCTGACATGG + Intronic
1093178072 12:15935661-15935683 TAAAAATAAAATGGCAGACTAGG - Intronic
1093466872 12:19458433-19458455 TGTGAATACAATGGCAGACAAGG - Intronic
1093639208 12:21506042-21506064 TGAATATACAGTGGTAGACGAGG - Intronic
1094118783 12:26946610-26946632 TGGCTATATAATATCAGACAAGG - Intronic
1094203340 12:27815600-27815622 TGAATGAATAAAGGCAGAGATGG + Intergenic
1094331246 12:29296147-29296169 GGATTATATAATTGCATACATGG - Intronic
1094726940 12:33129523-33129545 TGAATATATAAAGGAACAAATGG + Intergenic
1094790471 12:33907630-33907652 TTAAAATATAATGTCAGTCATGG - Intergenic
1095364046 12:41380811-41380833 TGAATATATAACACCAGATAAGG - Intronic
1096114610 12:49048260-49048282 TGAATTTATAAAGCCTGACATGG + Intronic
1098272861 12:68785777-68785799 TAAATATATAATTGCAAACTGGG - Intronic
1098587185 12:72167760-72167782 TGAAAATGTAATGGGAGACATGG + Intronic
1099371139 12:81831966-81831988 TGAATATAGAATTCTAGACAGGG - Intergenic
1099443084 12:82722099-82722121 TGTCTTTATAATGGCAGAAATGG - Intronic
1100141472 12:91623909-91623931 TGACAATATAATGGCTGAAAAGG - Intergenic
1100712257 12:97270164-97270186 TTAATATTTAATGACAGAAAAGG + Intergenic
1101205825 12:102486370-102486392 TAAATATGTAATAGCAGACGTGG + Intergenic
1103588605 12:121974359-121974381 TTAATAAATAAACGCAGACACGG - Intronic
1108067745 13:46595880-46595902 TGAATATTTTATGTAAGACAGGG + Intronic
1109019992 13:57078059-57078081 TGAATAAATAATTCCAGATATGG + Intergenic
1109512588 13:63398919-63398941 TTAATATATCATGACAGAAATGG - Intergenic
1109531991 13:63662148-63662170 TGATACTATAATGGTAGACATGG - Intergenic
1110298191 13:73894484-73894506 TAAAAATATAATGGCATTCATGG - Intronic
1111491933 13:88990103-88990125 TTAATATAGAATAGCAGACAAGG - Intergenic
1111620777 13:90722676-90722698 TGATTAAATAATGGTAGAAAGGG + Intergenic
1112000301 13:95203665-95203687 TCTATATTTAATGTCAGACATGG + Intronic
1113044664 13:106142537-106142559 TTAACATATAGTGGGAGACATGG - Intergenic
1115333589 14:32223224-32223246 TGAACATATATTGGAAGACATGG + Intergenic
1116090501 14:40298459-40298481 TAAATATAAGATGGCAGAAATGG - Intergenic
1116108795 14:40548372-40548394 TGACTATATAGTGAAAGACAGGG + Intergenic
1116169265 14:41378624-41378646 TGAATATTCTATGGCAGAGATGG + Intergenic
1116531390 14:45977711-45977733 TCAATATATAATCGCACATATGG + Intergenic
1117872745 14:60217962-60217984 TGAATATAGAGTGGCAGACAGGG + Intergenic
1120242759 14:81968659-81968681 TAAATATATATAGGCATACATGG + Intergenic
1121625334 14:95381376-95381398 TGAGGATACAGTGGCAGACAAGG + Intergenic
1121748180 14:96319540-96319562 TAAATATATAAAGGCAGAGTTGG + Intronic
1123483056 15:20653811-20653833 TAAATAAATAATGGCATAAATGG - Intergenic
1126526645 15:49663476-49663498 TGATTAAATAATGGCAGAATTGG - Intergenic
1127359873 15:58236049-58236071 TCAATGTATAATCCCAGACAGGG - Intronic
1127725809 15:61748546-61748568 AGACTATATAACAGCAGACATGG - Intergenic
1130007612 15:80115564-80115586 TGAATGTGTAATGGCATAGATGG - Intronic
1131129792 15:89890338-89890360 TGAAAAAATAAGGCCAGACATGG - Intronic
1131936788 15:97515130-97515152 TGAGTAAAAAATGGCAGACTTGG - Intergenic
1132526046 16:415306-415328 TAAATAAATAATGCCAGGCATGG + Intergenic
1133594252 16:7275260-7275282 GGAATATCTAATGACATACATGG - Intronic
1133624591 16:7559349-7559371 AGAATATATAAAGGAAGAGAGGG - Intronic
1135163686 16:20120025-20120047 TGAATATTTAATGATAGAAAAGG - Intergenic
1135449662 16:22546607-22546629 TGAAGATATCATTGGAGACACGG - Intergenic
1137921403 16:52492260-52492282 TAAATATATAATGGTTGAGAGGG + Intronic
1138538536 16:57673746-57673768 TGTATACAGAATGGCAGACAAGG + Intronic
1140265701 16:73418607-73418629 TGTATATATAATGGAAGGCAGGG - Intergenic
1144175576 17:12702951-12702973 TGAATAAAGAATGTCAGAAATGG - Intronic
1148292050 17:46461226-46461248 GAAATATATAATGGAATACAAGG + Intergenic
1148314238 17:46678923-46678945 GAAATATATAATGGAATACAAGG + Intronic
1150036787 17:61809968-61809990 GTAATATTTAATGGCGGACAAGG - Intronic
1150834973 17:68555803-68555825 TGAATAAAAAACTGCAGACAAGG - Intronic
1151538653 17:74752942-74752964 TGAATATATAACAACAGTCAGGG + Intronic
1153578620 18:6548987-6549009 TGTATGTATAATGTGAGACAGGG - Intronic
1156111928 18:33738694-33738716 TAAAGATATAATGGCAGAATTGG + Exonic
1157014645 18:43697472-43697494 TGAAAATTTAATAGCAGCCAAGG + Intergenic
1158180589 18:54710908-54710930 TGTATATTTAATGGCATGCAAGG - Intergenic
1159273390 18:66183097-66183119 TGGATATATAATTTCTGACAAGG - Intergenic
1159747951 18:72262823-72262845 TGTCTCTATTATGGCAGACAGGG + Intergenic
1159974176 18:74690152-74690174 CCTATATATAATGGCACACATGG + Intronic
1160170655 18:76550442-76550464 TTAATAAATAATGGCAGTAATGG - Intergenic
1161444921 19:4312848-4312870 TGAATATATTTTTCCAGACATGG + Intronic
1162632265 19:11938040-11938062 TGAATAAATAGAGGCAGAAAAGG - Intronic
1163942198 19:20505754-20505776 TCAACATATAATGGAAAACATGG - Intergenic
1167050194 19:47073277-47073299 TAAATAAATAATGCCAGACGTGG + Intronic
1167825987 19:51973647-51973669 TGAATATAGATTTGGAGACAGGG - Intronic
926082120 2:9995678-9995700 TGGATATTTACAGGCAGACATGG - Intronic
927060779 2:19417203-19417225 TTAGTATATAAAGGTAGACATGG + Intergenic
928686761 2:33758142-33758164 TGAATATAAAGTAACAGACATGG + Intergenic
928936047 2:36679287-36679309 TAGAGATATAATGGCAGACAAGG - Intergenic
929624491 2:43392737-43392759 AGAAGATACAATGCCAGACAGGG - Intronic
930644293 2:53888024-53888046 TCAATATGTAAAGGCAGAAAGGG - Intronic
931859128 2:66335262-66335284 TGTAAATAGAATGTCAGACAAGG - Intergenic
931878212 2:66537643-66537665 TGAATAATTAATGCTAGACAGGG + Intronic
933699487 2:85244333-85244355 TGATTATATCATGGCAGCCATGG - Intronic
933976232 2:87514153-87514175 TGATAATATAATAGCAGCCACGG + Intergenic
936317590 2:111436653-111436675 TGATAATATAATAGCAGCCACGG - Intergenic
937537600 2:122910157-122910179 TCTATATATAATGGCAGAGAGGG - Intergenic
939414495 2:141876935-141876957 TAAATATCTAATGGCATACTGGG - Intronic
940147555 2:150562913-150562935 TGAATAATTAATGTTAGACATGG + Intergenic
940510698 2:154610729-154610751 TAAATATTTAAGGGCAGGCACGG - Intergenic
941010582 2:160295144-160295166 TAAATGTATAATGCCAGACTTGG - Intronic
941312333 2:163949815-163949837 AGAAGATATAAAGGCAGAAAAGG + Intergenic
942238957 2:173941315-173941337 TGAATAGATAATGCTAGGCATGG + Intronic
942922461 2:181393013-181393035 TGAAAATAAAATGGCACACCAGG - Intergenic
943918268 2:193666518-193666540 TGAATATCAATTGGCAGAGATGG - Intergenic
944265972 2:197727126-197727148 TGAATGTATACTAGCATACAAGG - Exonic
945040782 2:205742229-205742251 TGAATAAATGATGTCAGGCAAGG - Intronic
945406418 2:209454337-209454359 TGAATATATAAAGAGAGAGATGG + Intronic
947432061 2:230039381-230039403 TTAATCTATAATTGGAGACAAGG + Intronic
947581271 2:231320447-231320469 TAAAAATATAAAGGTAGACAGGG - Intronic
948190503 2:236054738-236054760 TAAATAGATGAGGGCAGACAGGG - Intronic
1170463970 20:16606161-16606183 TGAATTTACAATGGATGACAAGG + Intergenic
1172265958 20:33614338-33614360 TAAATACACAATGGCAAACAGGG - Intronic
1172457387 20:35088440-35088462 TGAATATCAAATGGCTGGCAAGG + Intronic
1180991344 22:19938752-19938774 TCAACATATAATGGAAAACATGG + Intronic
1182730687 22:32489114-32489136 TGAACATTTAATGTCAGACTAGG + Intronic
1184310230 22:43636566-43636588 TGAATAGAAAGTGGCAGACCTGG + Intronic
951067284 3:18281674-18281696 ACAAGCTATAATGGCAGACAGGG - Intronic
951331620 3:21376443-21376465 TGAAAATATAATGGAAGATGTGG - Intergenic
953372810 3:42404940-42404962 TGTATATAAAATGCCAGGCAGGG - Intronic
953516561 3:43598192-43598214 GGAATATAAAAGGGAAGACATGG - Intronic
953870679 3:46624849-46624871 TGAAAATATATTTGCAGTCAGGG - Intronic
955108422 3:55923544-55923566 AGAAGATATAATAGCAAACAAGG + Intronic
955660500 3:61293975-61293997 TGAAAGAATAATTGCAGACATGG - Intergenic
956974379 3:74563369-74563391 TGAATTAATAATGGCATACGTGG + Intergenic
958001588 3:87757160-87757182 TGAATGTATAATTGCAAATAAGG + Intergenic
959888195 3:111526171-111526193 TCAACATATAATGGAAAACATGG + Intronic
960880328 3:122338324-122338346 TTAATATATAAGGACAAACATGG - Intronic
962488116 3:135864428-135864450 TGAATAGATAGTGGCAGCCCAGG - Intergenic
964247765 3:154673588-154673610 AAATTATATAATGGTAGACATGG - Intergenic
967731069 3:192907392-192907414 TGATTCTATAGTCGCAGACAAGG - Intronic
968537520 4:1143835-1143857 TGAATATATAAAGGAACACGGGG + Intergenic
970116638 4:12704266-12704288 TGAATATGTAATGATATACAGGG - Intergenic
970498977 4:16657466-16657488 TGCATAGATAATGGATGACAAGG - Intronic
971744084 4:30556831-30556853 GGACTTTACAATGGCAGACAAGG - Intergenic
971886145 4:32450702-32450724 TGATTATATAATGGCTGTAAAGG - Intergenic
972587471 4:40450944-40450966 TGATTATATACTGGCACACATGG + Intronic
973606721 4:52594524-52594546 TGACCATATAATAGCAAACAAGG + Exonic
973827143 4:54719752-54719774 TGTATATTTAATGCCAAACACGG + Intronic
974223440 4:59006626-59006648 TAAATATATAAGGCCAGGCATGG + Intergenic
975835949 4:78422357-78422379 TGAATATTTAATTGCAGTCTGGG + Intronic
975950102 4:79760258-79760280 TGAATAGTTATTGGCAGAAATGG - Intergenic
976121915 4:81792396-81792418 TGAATATATAAGAGGAAACAAGG + Intronic
976752350 4:88462288-88462310 TGAATAAATGTTGCCAGACATGG - Exonic
976885632 4:89980269-89980291 TTAATATATAATGGCATCCAGGG - Intergenic
977219724 4:94325062-94325084 TGGTGATATAATGGCAAACAGGG - Intronic
977330175 4:95628116-95628138 TGTATTTAAAAGGGCAGACAGGG + Intergenic
977533807 4:98232575-98232597 TAAAAATATAAAAGCAGACACGG + Intergenic
978500294 4:109402041-109402063 TTAAAATATAATAGCAGAAATGG + Intergenic
979016687 4:115443228-115443250 TAAATATATACTGGCATCCACGG + Intergenic
979945608 4:126827990-126828012 GGAAGATAAAATGCCAGACACGG - Intergenic
980786456 4:137562460-137562482 TAAGAATATAAGGGCAGACAAGG + Intergenic
982302346 4:153892571-153892593 TTATTATATATTTGCAGACAGGG + Intergenic
983123039 4:163912301-163912323 AGAATAGATACTGGCAGACAAGG + Intronic
984318120 4:178155933-178155955 TGCATATGTAAAGGCATACAGGG - Intergenic
987156468 5:15094836-15094858 TGAATCTATAATGATAGCCAAGG - Intergenic
987210469 5:15676918-15676940 AGAATATAAAATGGCAGGTATGG - Intronic
987235079 5:15934922-15934944 TAAATATATAATGCCACCCAGGG + Intronic
987692732 5:21288515-21288537 TAAAAATATAATGGAAGAAAAGG + Intergenic
987954909 5:24726852-24726874 AGACTATAGAATGGTAGACAAGG + Intergenic
988079227 5:26394837-26394859 TGAATATATATTTTCAGAGATGG + Intergenic
988556710 5:32242781-32242803 TGAATATATAATGGCAGACAGGG - Intronic
990315038 5:54575810-54575832 TGTAAAACTAATGGCAGACAAGG - Intergenic
991322249 5:65387241-65387263 TGAATATATATTTGCACTCATGG - Intronic
991385058 5:66078158-66078180 TTAAGAAATAATGTCAGACATGG - Intronic
991420868 5:66440258-66440280 TGAATAAAACATAGCAGACACGG + Intergenic
992220202 5:74564388-74564410 TGTATATATTTTGGCATACATGG - Intergenic
994406213 5:99348496-99348518 TGAATGTATAGTGACAGAAATGG - Intergenic
994498240 5:100540464-100540486 TAAATAAATAATGGCAAACCAGG - Intronic
995760751 5:115559052-115559074 TTAATGAATTATGGCAGACACGG - Intergenic
996278298 5:121695731-121695753 TGAACATATAATTGCATACAAGG + Intergenic
997804712 5:136905719-136905741 TGAATACACAGAGGCAGACAGGG - Intergenic
999774518 5:154801576-154801598 TGAGTATATAATGGAAAGCAAGG + Intronic
1000628143 5:163562960-163562982 TGAAGATATAATCTCAAACATGG + Intergenic
1005117230 6:22352169-22352191 TGAAAATAGAATGGAAGATATGG - Intergenic
1007328740 6:41086219-41086241 TGCTTATTTAATGGCAGACCTGG - Intronic
1007848817 6:44783541-44783563 TGAATACCTAGTGGCAGAAAGGG + Intergenic
1009827173 6:68881462-68881484 TGAATATACATTGGCATGCAAGG + Intronic
1011073541 6:83412349-83412371 TGATTATATTACGGCAGAGATGG + Intronic
1011195881 6:84778871-84778893 TGTATATATCCTGGCTGACATGG - Intergenic
1012728801 6:102852831-102852853 TTTATATAAAATGGCAGAAAGGG + Intergenic
1012808943 6:103933491-103933513 AGAATATATAATGCCACTCATGG + Intergenic
1013830033 6:114260837-114260859 GGAATATAAAATGGCAAAAAAGG + Intronic
1015449845 6:133353904-133353926 AGAATATTTAATGTCAGAAATGG - Intronic
1016776914 6:147914496-147914518 TAAATTGATAATGGCAGAAAAGG + Intergenic
1017485010 6:154894708-154894730 TAAATAAATAATGCCGGACATGG + Intronic
1017850664 6:158302754-158302776 TCAAAATATAATGGAAAACATGG - Intronic
1020349507 7:7202360-7202382 TGGGAAAATAATGGCAGACAGGG - Intronic
1020989222 7:15175709-15175731 TGAAAATAGAATGGATGACAAGG - Intergenic
1021386972 7:20043544-20043566 TAAATATATTGTGGCAGCCATGG + Intergenic
1021971186 7:25967395-25967417 TGGCTAGATTATGGCAGACATGG - Intergenic
1022797389 7:33742888-33742910 TGAATGTCTAATGGCAGGCCTGG + Intergenic
1023070919 7:36432394-36432416 TGAATATTTAATGCCAGCAAAGG - Intronic
1023133884 7:37031687-37031709 TGAATATATAAAGACAGAGAAGG - Intronic
1027456386 7:78397040-78397062 TGGATATAAAATGGTAGAAAGGG + Intronic
1027754549 7:82195840-82195862 AGGATAGATAATGGCAGAAAGGG + Intronic
1031402288 7:121339590-121339612 GGAATATATATTGACATACAAGG + Exonic
1032106240 7:129033617-129033639 TGAATATAAAATCTCAAACAGGG + Intronic
1032276613 7:130462075-130462097 TGAATATTTAATAGAAGTCAGGG + Intergenic
1033102325 7:138484791-138484813 TGAATATATGGTAGCAGTCAGGG + Intronic
1033840165 7:145363220-145363242 TAAATATATAAAGTCAGAAAAGG + Intergenic
1033885274 7:145936666-145936688 TGAATAGAATATGGCAGAAATGG + Intergenic
1038047460 8:23777890-23777912 GGAATATATAAAGACAGACAGGG + Intergenic
1038879856 8:31597035-31597057 TGAATATAAAATTCCAGAAAAGG - Intergenic
1040524387 8:48206608-48206630 TGAAGAAATAATGGCTGAAAAGG + Intergenic
1041964425 8:63658558-63658580 GGAATAAATACTGGCAGAGAAGG - Intergenic
1042096724 8:65224249-65224271 TGAATATATTTTGGCACAAAAGG - Intergenic
1043406908 8:79945607-79945629 TGAATTTAAAATGGCAGAAATGG + Intronic
1043470878 8:80561225-80561247 TGTATATACAATGGCAGTGACGG + Intergenic
1044223061 8:89692007-89692029 TGAATATTTTATGGAAGAAAAGG - Intergenic
1044600746 8:94001607-94001629 TTAATATATAACAGCAGATATGG - Intergenic
1044641891 8:94391533-94391555 TGAATCTAAGAGGGCAGACAGGG - Intronic
1045983798 8:108223802-108223824 AGAATAAATTATGGCAGAAATGG + Intronic
1045989270 8:108286569-108286591 TGAAGAAAGAATGGAAGACAGGG + Intronic
1046680226 8:117160856-117160878 TGAAAATAGAATGGGATACATGG + Intronic
1046712187 8:117522360-117522382 TGTATACATAGTGGCAGATACGG + Intronic
1047045018 8:121043212-121043234 TGTATATATAATAGCAAATATGG - Intergenic
1047624759 8:126645242-126645264 TGTATCTATAATGGCAAACATGG - Intergenic
1050304418 9:4293865-4293887 TGAAGAGATCATGTCAGACAAGG + Intronic
1050847769 9:10244676-10244698 TGAAAATATAATGGCCCATATGG + Intronic
1050994039 9:12191024-12191046 AGAATATATTATGAAAGACAGGG + Intergenic
1051393569 9:16593287-16593309 TGAATATATAAATACAAACAGGG + Intronic
1051414792 9:16828047-16828069 TGAACATATCATTGCAGACATGG - Intronic
1052687586 9:31774601-31774623 TTAACATATAATGGAAAACATGG + Intergenic
1058266620 9:102907135-102907157 TGAATATGTAAATGAAGACAAGG - Intergenic
1059198845 9:112396076-112396098 TCAACATATAATGGAAAACATGG - Intronic
1059974317 9:119699456-119699478 AGCATATATTATGTCAGACATGG + Intergenic
1060503805 9:124182770-124182792 TGTATCTATAATGGCAGAGCTGG - Intergenic
1060783093 9:126427898-126427920 TGAATCTATCCTGGCAGACTGGG + Intronic
1062247922 9:135579047-135579069 TGAATAAATAATGGAATAAATGG - Intergenic
1185906626 X:3939488-3939510 TGAATTTAAAATGGGAGGCATGG - Intergenic
1186210506 X:7245525-7245547 TGAATAAATAATGACAGAGAAGG - Intronic
1186526029 X:10249160-10249182 TGAATATATTATGAGAGTCAGGG - Intergenic
1190145790 X:47890556-47890578 TGAAGTGACAATGGCAGACAGGG - Intronic
1190915183 X:54806572-54806594 TGAATATATAAATGCAGACCTGG - Intergenic
1190922256 X:54865168-54865190 TGTGTATATAGTGGGAGACAAGG + Intergenic
1192142669 X:68659030-68659052 TGAAGATATAATGTCATAGATGG + Intronic
1193546916 X:82842773-82842795 GGAATATATAATGTCAGAGGAGG - Intergenic
1194454042 X:94080318-94080340 TCAATATATAATTGCACACCTGG + Intergenic
1194626600 X:96233037-96233059 TGAAGAGGCAATGGCAGACAGGG + Intergenic
1196654895 X:118207683-118207705 TGAATTTATCAAGGCAGAGAAGG - Intergenic
1197031546 X:121822351-121822373 TGAACATCTAATGGAACACAAGG + Intergenic
1198774266 X:140162934-140162956 AGAATATATAGTGGCAAACCGGG + Intergenic
1198844235 X:140892894-140892916 GGAATATAGAATGGTCGACATGG - Intergenic
1199356365 X:146867763-146867785 GGTGTATGTAATGGCAGACAAGG - Intergenic
1199807412 X:151314096-151314118 TGAATTTTTCATGGCAAACAGGG - Intergenic
1200795294 Y:7336053-7336075 TGAGTATTTAATGGAAGCCAAGG + Intergenic
1201572079 Y:15425389-15425411 AGAAAATAGAAAGGCAGACAGGG + Intergenic