ID: 988556711

View in Genome Browser
Species Human (GRCh38)
Location 5:32242782-32242804
Sequence TTGAATATATAATGGCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 194}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988556711_988556717 28 Left 988556711 5:32242782-32242804 CCTGTCTGCCATTATATATTCAA 0: 1
1: 0
2: 2
3: 14
4: 194
Right 988556717 5:32242833-32242855 AGCACAGTTCAGTGTCTGGAGGG 0: 1
1: 0
2: 1
3: 16
4: 209
988556711_988556716 27 Left 988556711 5:32242782-32242804 CCTGTCTGCCATTATATATTCAA 0: 1
1: 0
2: 2
3: 14
4: 194
Right 988556716 5:32242832-32242854 GAGCACAGTTCAGTGTCTGGAGG No data
988556711_988556713 -3 Left 988556711 5:32242782-32242804 CCTGTCTGCCATTATATATTCAA 0: 1
1: 0
2: 2
3: 14
4: 194
Right 988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG 0: 1
1: 0
2: 1
3: 3
4: 61
988556711_988556715 24 Left 988556711 5:32242782-32242804 CCTGTCTGCCATTATATATTCAA 0: 1
1: 0
2: 2
3: 14
4: 194
Right 988556715 5:32242829-32242851 CTGGAGCACAGTTCAGTGTCTGG 0: 1
1: 0
2: 1
3: 19
4: 186
988556711_988556714 5 Left 988556711 5:32242782-32242804 CCTGTCTGCCATTATATATTCAA 0: 1
1: 0
2: 2
3: 14
4: 194
Right 988556714 5:32242810-32242832 GAGACGTGTAGCAGGATGTCTGG 0: 1
1: 0
2: 0
3: 16
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988556711 Original CRISPR TTGAATATATAATGGCAGAC AGG (reversed) Intronic
900825184 1:4920638-4920660 TTGAACAGATGATGGCAGAATGG + Intergenic
902320784 1:15663910-15663932 TGGAATATATAATATCAGTCGGG + Exonic
905770033 1:40631411-40631433 TCTAATATAAAATGGCAGCCAGG + Intronic
906262026 1:44400287-44400309 TAGAAGATATAAGGGGAGACTGG - Intergenic
909982323 1:82117341-82117363 TTCATTTTATAATGGGAGACAGG - Intergenic
911548435 1:99250571-99250593 TTGAACCTACAATGGCAGAGTGG - Intergenic
911591002 1:99747601-99747623 TTGAATATCTTATGGAACACTGG - Intronic
911791266 1:102018292-102018314 TTTAACATATAATTGCTGACAGG + Intergenic
912807480 1:112768912-112768934 TTCAACATATACTAGCAGACTGG - Intergenic
917461440 1:175234067-175234089 TTGAGAAGATCATGGCAGACGGG + Intergenic
918699032 1:187583558-187583580 CTGAATATACACTGGCAAACAGG - Intergenic
919329682 1:196155091-196155113 TTAAATATATAATGGTAGGTGGG + Intergenic
920758938 1:208763107-208763129 TAGAATATATAATGTCTGGCCGG + Intergenic
924369235 1:243330068-243330090 TTGAATATATCATTACACACAGG - Intronic
924410988 1:243805388-243805410 TTGTATATGTGATGGCAGAGGGG - Intronic
924477322 1:244393649-244393671 ATGAATATTTAATTGCACACTGG + Intergenic
924664203 1:246053624-246053646 TTGAATATGTTATGGCATAAGGG - Intronic
1064689521 10:17900958-17900980 TTGAATATATAAAAACAGTCAGG + Intronic
1064861494 10:19831245-19831267 TTGAATATGTAATATCAGAATGG - Intronic
1065146611 10:22775342-22775364 TTGCATAGATAATTTCAGACAGG + Intergenic
1066026820 10:31366212-31366234 TTGAATATACCAGGACAGACTGG + Intronic
1069244954 10:66192671-66192693 TTGAATAAATAAAGGCAGGCTGG - Intronic
1069334251 10:67329069-67329091 TTTAATATAAAATGGCAAATGGG + Intronic
1069980641 10:72249974-72249996 TTTAATAAATAGTGGCAGCCAGG - Intergenic
1070238227 10:74652797-74652819 TTAAATATATACTAGCATACTGG - Intronic
1072550083 10:96470486-96470508 CTGAATAAATAATAGCAGGCAGG + Intronic
1075690724 10:124392433-124392455 TCTAAAATATAATGGCAGTCAGG + Intergenic
1081073900 11:38643987-38644009 TTAAAAATATAATGGAATACTGG - Intergenic
1082985066 11:59161364-59161386 TTGAAAATAGCATGGCAGCCAGG + Intergenic
1085237918 11:75029756-75029778 TTGAATAAAGCATGGCAGAAGGG - Intergenic
1085741772 11:79083298-79083320 TAGACAAGATAATGGCAGACTGG + Intronic
1089112723 11:116069728-116069750 TTGAATATATTATGGTTCACAGG + Intergenic
1090674343 11:128975403-128975425 TTGAATCTATAATAGCAAAATGG + Intronic
1092531063 12:9345766-9345788 TAGAAAATATAATGTCAGGCTGG - Intergenic
1094220057 12:27983129-27983151 TTGAATATATATTGGCAATGTGG + Intergenic
1096324260 12:50644836-50644858 TGAAATATGTAATGGCAAACTGG - Intronic
1098077123 12:66743856-66743878 TTGAATATGTAATGGAGGAAAGG - Intronic
1098272862 12:68785778-68785800 ATAAATATATAATTGCAAACTGG - Intronic
1098869152 12:75797483-75797505 TTGCATATACAGTGGGAGACAGG + Intergenic
1099006972 12:77245515-77245537 TTGTATATATCATGGCAGACTGG + Intergenic
1099647664 12:85379955-85379977 TTAAATATATAACAGCAAACTGG + Intergenic
1100906735 12:99309193-99309215 TTTAAAATATAATGGCAACCTGG - Intronic
1101099489 12:101377812-101377834 TTAAACATATAATGGAAGATGGG - Intronic
1101099709 12:101379797-101379819 TTAAACATATAATGGAAGATGGG - Intronic
1102678670 12:114675350-114675372 CTGAATTGATAATGGCAGAACGG + Intronic
1103866649 12:124057536-124057558 TTGAAAATATAATGACATATGGG + Intronic
1105712600 13:23027008-23027030 TAGAATATGTAATTGCACACTGG + Intergenic
1105822082 13:24088766-24088788 TTGATTAAATGATGGCAGATTGG - Intronic
1108067744 13:46595879-46595901 TTGAATATTTTATGTAAGACAGG + Intronic
1108617263 13:52145703-52145725 TGGGATATACAATGACAGACTGG + Intronic
1109044714 13:57394694-57394716 TTGAATACATAAAAGGAGACAGG - Intergenic
1109746111 13:66624903-66624925 TTAAGTACATAGTGGCAGACTGG - Intronic
1110073663 13:71211282-71211304 TTTAATATATATTTGCAGATAGG + Intergenic
1111055623 13:82945880-82945902 TTTATTATATAATGGCTTACTGG - Intergenic
1111620776 13:90722675-90722697 TTGATTAAATAATGGTAGAAAGG + Intergenic
1111732053 13:92088448-92088470 TTGAAGATAAAATGGCCCACTGG + Intronic
1112640695 13:101271049-101271071 ATGAAAATATAATAGGAGACAGG + Intronic
1113277470 13:108747793-108747815 TTGAATATAAAGATGCAGACAGG + Intronic
1113795422 13:113054620-113054642 TTAAATATATAATGTCAAGCTGG + Intronic
1114333508 14:21662593-21662615 TAAAATATATAATGCCAGCCAGG - Intergenic
1114540641 14:23455242-23455264 TTGAAGTAATAATGGCAGGCTGG + Intergenic
1115871345 14:37806957-37806979 TTGGATATATAATGGCAGTGTGG + Intronic
1116268456 14:42727937-42727959 TTCAAAATATAATGATAGACTGG + Intergenic
1117872744 14:60217961-60217983 TTGAATATAGAGTGGCAGACAGG + Intergenic
1123670532 15:22652200-22652222 TTGAAGATAAAATGGCCCACTGG + Intergenic
1124030296 15:26004504-26004526 ATGATTATATAATGGTAGATTGG - Intergenic
1124526514 15:30458637-30458659 TTGAAGATAAAATGGCCCACTGG + Intergenic
1126243184 15:46469195-46469217 TGGAATACACATTGGCAGACAGG + Intergenic
1128005030 15:64230675-64230697 TTAAAAATAAAATGGCAGCCGGG + Intronic
1131193001 15:90332234-90332256 TGGACTACATACTGGCAGACTGG + Intergenic
1135103573 16:19627611-19627633 TTGAATATATATTGCCAGGAAGG - Intronic
1138476665 16:57274402-57274424 TTGAGTATCAAATGGAAGACAGG - Intronic
1140265702 16:73418608-73418630 TTGTATATATAATGGAAGGCAGG - Intergenic
1140683968 16:77415191-77415213 TTGAGCATATACTGGCTGACAGG - Intronic
1148541328 17:48483011-48483033 TTGAAAAGATGATGGCAGTCTGG + Intergenic
1149711446 17:58745846-58745868 TTAAATATTTAATGGCAGCCAGG - Intergenic
1150530394 17:65975239-65975261 GTAAATATATAATGGAAGTCAGG + Intronic
1151645132 17:75425492-75425514 TAGAAAAAATAATGGCAGGCCGG + Intergenic
1153578621 18:6548988-6549010 TTGTATGTATAATGTGAGACAGG - Intronic
1154487772 18:14890075-14890097 TTGAATATATCATGGAAATCAGG - Intergenic
1155457852 18:26039936-26039958 CTCATTATATAATGGTAGACAGG + Intronic
1156890978 18:42189025-42189047 TTGATTATAAAATGGCAAAGGGG - Intergenic
1156926252 18:42583658-42583680 TTGAGTATATTACTGCAGACAGG - Intergenic
1158081417 18:53595699-53595721 TTGGATATAAAATGTCATACAGG - Intergenic
1161168268 19:2800156-2800178 TTAAATAAATAAAGGCAGGCAGG - Intronic
1167825988 19:51973648-51973670 TTGAATATAGATTTGGAGACAGG - Intronic
925227460 2:2197243-2197265 TTGAATAAATAATGACTGAAAGG - Intronic
925318553 2:2943411-2943433 TTAAAAATATAAAGGCAGGCTGG + Intergenic
926574992 2:14570376-14570398 TGAAATCTATAATGGCAGAAGGG - Intergenic
926744740 2:16141694-16141716 TTAAATATTTCATAGCAGACTGG + Intergenic
927036807 2:19186071-19186093 TTGAATATATCATGGCTAAGTGG - Intergenic
928740473 2:34346416-34346438 TAGAATTTGGAATGGCAGACAGG - Intergenic
931798832 2:65738565-65738587 TTGATTATAAAATGGATGACTGG - Intergenic
932802794 2:74756883-74756905 TTTAAAATATAATAGAAGACAGG + Intergenic
933139185 2:78772648-78772670 TTGAAAATATTATGTCAGTCTGG - Intergenic
935496064 2:103783046-103783068 TGGGATATATGATGGCATACTGG + Intergenic
936879214 2:117230075-117230097 TTAGATACATAATGGCAGAATGG - Intergenic
937537601 2:122910158-122910180 TTCTATATATAATGGCAGAGAGG - Intergenic
939057788 2:137384355-137384377 CTGAAGTTATAATGGCAGACAGG - Intronic
939414496 2:141876936-141876958 TTAAATATCTAATGGCATACTGG - Intronic
941104427 2:161336338-161336360 TTGAATATTTTATGGCATATTGG + Intronic
941911513 2:170769594-170769616 ATGAATGGATAATGGCTGACTGG - Intergenic
942735506 2:179106888-179106910 CTTAATATATAATGGCAGTTTGG - Exonic
944391149 2:199221021-199221043 TTGAATATTGAATGGCAAAAAGG - Intergenic
944757983 2:202783822-202783844 ATGAATATTTAGTGGCAGAGAGG + Intronic
944840682 2:203620987-203621009 TTGAAGATATAAGGGCAGATGGG + Intergenic
946189392 2:218000104-218000126 TTGAATATGTAATAGCAAATGGG + Intronic
1171450337 20:25231377-25231399 ATGAATATCTAAAGGCAGAATGG + Intergenic
1171450851 20:25235268-25235290 ATGAATATCTAAAGGCAGAATGG + Intergenic
1182854031 22:33501491-33501513 TTGAATATAGAGTGGGAGATGGG + Intronic
1183325580 22:37190186-37190208 TTTAATAAAAAATGGGAGACTGG - Intronic
951846512 3:27090276-27090298 TTGAAGAAATCATGGCATACCGG - Intergenic
953870680 3:46624850-46624872 TTGAAAATATATTTGCAGTCAGG - Intronic
956028923 3:65015131-65015153 TAGAAAATATAATGGCAGCTGGG + Intergenic
956522342 3:70119477-70119499 ATAAATATATAATGGCACAGAGG + Intergenic
957190103 3:76996643-76996665 TTGAATTTAAAATGGCTGATGGG - Intronic
957321882 3:78642077-78642099 TCGAATATATAAGGGTAGCCTGG - Intronic
957337041 3:78844328-78844350 TTAAAAAAATAATTGCAGACAGG - Intronic
958504315 3:94954645-94954667 TTGAATCTATAAGGACAAACTGG + Intergenic
959190819 3:103108557-103108579 TTAAATAAATAAGGGCAGATGGG + Intergenic
959219903 3:103504616-103504638 TTGAGTATACCATGGCACACAGG + Intergenic
959630156 3:108498671-108498693 TTGTATAGATAAAGGCAGGCAGG - Intronic
963619009 3:147580976-147580998 TTGAAAATATTTTGGCAGCCAGG - Intergenic
964567309 3:158071109-158071131 TTGATCATCTAATGCCAGACAGG + Intergenic
968537519 4:1143834-1143856 CTGAATATATAAAGGAACACGGG + Intergenic
970615540 4:17765428-17765450 TATAATATATAATGACAAACTGG + Intronic
971639344 4:29110562-29110584 TAGAATCTATAATGGCATATTGG - Intergenic
973686926 4:53379658-53379680 TTGATGATATAATGGCAGTTTGG + Intronic
974729174 4:65838965-65838987 TTGAGGATTTAATGACAGACAGG - Intergenic
975835948 4:78422356-78422378 ATGAATATTTAATTGCAGTCTGG + Intronic
976427816 4:84926821-84926843 TTGAATTGATTATGGCAGAGGGG - Intronic
976885633 4:89980270-89980292 TTTAATATATAATGGCATCCAGG - Intergenic
977153626 4:93545470-93545492 ATGAGTAGGTAATGGCAGACTGG + Intronic
977840353 4:101695220-101695242 TTGACAGTATAATGGAAGACAGG + Intronic
980200028 4:129644433-129644455 TTGAATTCAAAATGGAAGACTGG - Intergenic
980204768 4:129703221-129703243 TTGAATATATATTGTAAGGCTGG + Intergenic
980283972 4:130758127-130758149 TTTATTATATAATGGAAGAAAGG + Intergenic
980772193 4:137389354-137389376 ATGATTATATAATGCCAGAATGG - Intergenic
980993581 4:139759780-139759802 ATGAATAAATAATGGAATACTGG + Intronic
982302345 4:153892570-153892592 TTTATTATATATTTGCAGACAGG + Intergenic
982458811 4:155642092-155642114 TTAAATATATAATTCCAGACTGG - Intergenic
982566608 4:156995083-156995105 TTGAGTATATAATGGGTGCCAGG + Intergenic
982819023 4:159923590-159923612 TTAAAAATATAATGGCTGGCCGG + Intergenic
983762249 4:171425378-171425400 ATGACAATATAAGGGCAGACAGG + Intergenic
987911432 5:24151736-24151758 GTGTATATATAATGTCAGCCTGG - Intronic
988122578 5:26985890-26985912 TTGCATATATAGTGGCTAACTGG - Intronic
988219688 5:28327294-28327316 TTAAAAATAAAATGTCAGACAGG + Intergenic
988556711 5:32242782-32242804 TTGAATATATAATGGCAGACAGG - Intronic
992942060 5:81772304-81772326 TTGATTATATAGTAGCGGACTGG + Intergenic
993007628 5:82445367-82445389 TTGAAGGAAGAATGGCAGACTGG - Intergenic
993963848 5:94335881-94335903 TTTAAAATATTATGGCAGTCTGG - Intronic
994328518 5:98478588-98478610 TTCTATATATAATGGCATTCTGG + Intergenic
998244157 5:140481789-140481811 TTGCATATATAATGAAAGAGGGG + Intronic
998874620 5:146586792-146586814 TGGGATATATAAAGGCAGATGGG - Intronic
1000157477 5:158565892-158565914 TAGAACACAGAATGGCAGACTGG - Intergenic
1002578289 5:180190871-180190893 TTGAGAATAAAATGGCAGCCAGG + Intronic
1004724297 6:18296379-18296401 TTTAATATATAAAGTCAGAAGGG - Intergenic
1011340613 6:86308946-86308968 TTGAAAATATACTGTCAGAGGGG + Intergenic
1011811529 6:91137617-91137639 CAGAATATATACTGGCAGAGGGG - Intergenic
1011888225 6:92124679-92124701 TTGAATACATAAAAGCAGACAGG + Intergenic
1012728800 6:102852830-102852852 TTTTATATAAAATGGCAGAAAGG + Intergenic
1012884441 6:104829688-104829710 TTGATTATGTAATGGCCAACAGG - Intronic
1013467165 6:110427772-110427794 TTCAATATATAATAGCAGTAGGG - Intronic
1013879954 6:114885488-114885510 TTTAATAAATATTGGCAGAGGGG - Intergenic
1014006679 6:116427467-116427489 TTAAATATATAATTGGAGATTGG + Intronic
1015153803 6:130067549-130067571 GTGAAAAAATAATGGCAGAGTGG + Intronic
1016942640 6:149495876-149495898 TAGAATATATAAATGGAGACTGG + Intergenic
1017479269 6:154833444-154833466 TGTAATAGATAATGGCTGACTGG + Exonic
1017703653 6:157099559-157099581 TTGAATCTATGATAGCAGGCTGG + Intronic
1018244587 6:161810417-161810439 TTGAATGGATTATGACAGACTGG + Intronic
1020733356 7:11912917-11912939 ATGACTATATAAAGGCAGAAAGG + Intergenic
1020749143 7:12117626-12117648 GAGAATATAAAATGGCATACTGG + Intergenic
1023677380 7:42644449-42644471 TTAAATAAAAAATGACAGACAGG - Intergenic
1023802462 7:43846708-43846730 TTAAATATATATTTGCAGGCTGG + Intergenic
1025097590 7:56108588-56108610 TTAAAAAAATAATGGCAGGCTGG + Intergenic
1027823486 7:83079536-83079558 TTGAATATAAAATAGCTAACTGG + Intronic
1032276612 7:130462074-130462096 TTGAATATTTAATAGAAGTCAGG + Intergenic
1032746776 7:134794036-134794058 CTGCATGTATCATGGCAGACAGG - Intronic
1033102324 7:138484790-138484812 TTGAATATATGGTAGCAGTCAGG + Intronic
1036459714 8:8941145-8941167 TTGAAAGAATTATGGCAGACAGG + Intergenic
1038047459 8:23777889-23777911 AGGAATATATAAAGACAGACAGG + Intergenic
1040654497 8:49490331-49490353 TTTAATAGATACTGTCAGACAGG - Intergenic
1040888131 8:52287684-52287706 TTGCATATACAAAGGGAGACAGG + Intronic
1041897013 8:62937149-62937171 TTGCAAAGAAAATGGCAGACAGG + Intronic
1042434929 8:68752728-68752750 TTGTGTATATAATGGGTGACTGG + Intronic
1042438038 8:68791017-68791039 TTGAATATAAAATGTGAGTCTGG + Intronic
1043377887 8:79670470-79670492 TTCAATATGTAATGGCAAAATGG + Intergenic
1047282145 8:123455025-123455047 TTGAAAACAAAATGGAAGACAGG - Intronic
1048614172 8:136056404-136056426 CTGAAGATATATAGGCAGACAGG - Intergenic
1050927542 9:11284487-11284509 TTGACAATATAGTGGCAGAAAGG - Intergenic
1050994038 9:12191023-12191045 TAGAATATATTATGAAAGACAGG + Intergenic
1052092041 9:24340322-24340344 TTGATTCTATCATGGCAGACAGG - Intergenic
1055398558 9:75898990-75899012 CTGAATGCATAATGGCAGAGTGG + Intronic
1058046375 9:100362038-100362060 TAGAATATATATTGACAGCCGGG + Intergenic
1060675327 9:125509048-125509070 TTTAAAATATAATAGCAGAGTGG + Intronic
1060783092 9:126427897-126427919 CTGAATCTATCCTGGCAGACTGG + Intronic
1062074504 9:134577759-134577781 CTGAATATAGAATTCCAGACGGG - Intergenic
1186643256 X:11479862-11479884 TTGCAAATGTAAAGGCAGACTGG - Intronic
1188330817 X:28869255-28869277 TTGATTATATGATGGCAGTGAGG - Intronic
1190145791 X:47890557-47890579 TTGAAGTGACAATGGCAGACAGG - Intronic
1190824529 X:54005170-54005192 TTCAAGAAATAATGGCAGCCTGG + Intronic
1194058580 X:89167527-89167549 TTGGATACATAATGGCAGAAAGG + Intergenic
1194476506 X:94365729-94365751 TTAAAAATAAAATGGCAGGCAGG - Intergenic
1194626599 X:96233036-96233058 TTGAAGAGGCAATGGCAGACAGG + Intergenic
1195332761 X:103818391-103818413 TTTAATATATACTGGCAAATTGG - Intergenic
1195421873 X:104684539-104684561 TTGATTATAAAATGTCAGAGTGG + Intronic
1197468221 X:126833376-126833398 ATGAATATTTAAGGGCACACTGG - Intergenic
1197594957 X:128453548-128453570 TTTCAAGTATAATGGCAGACTGG + Intergenic
1198769421 X:140113639-140113661 ATGAATATAAAATTGCAGATAGG - Intergenic
1198774265 X:140162933-140162955 TAGAATATATAGTGGCAAACCGG + Intergenic
1201301229 Y:12506742-12506764 TTCAATATAAACTTGCAGACTGG - Intergenic