ID: 988556713

View in Genome Browser
Species Human (GRCh38)
Location 5:32242802-32242824
Sequence CAAATTATGAGACGTGTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988556711_988556713 -3 Left 988556711 5:32242782-32242804 CCTGTCTGCCATTATATATTCAA 0: 1
1: 0
2: 2
3: 14
4: 194
Right 988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG 0: 1
1: 0
2: 1
3: 3
4: 61
988556710_988556713 -2 Left 988556710 5:32242781-32242803 CCCTGTCTGCCATTATATATTCA 0: 1
1: 0
2: 2
3: 24
4: 246
Right 988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG 0: 1
1: 0
2: 1
3: 3
4: 61
988556709_988556713 11 Left 988556709 5:32242768-32242790 CCATAACATTTATCCCTGTCTGC 0: 1
1: 0
2: 0
3: 9
4: 166
Right 988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG 0: 1
1: 0
2: 1
3: 3
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988556713 Original CRISPR CAAATTATGAGACGTGTAGC AGG Intronic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
907933792 1:59023911-59023933 CAAATTATGAGACATAAATCAGG + Intergenic
910135938 1:83969995-83970017 CAAATTGTGACATGTGAAGCAGG - Intronic
916187530 1:162147514-162147536 CACATTATGATTCGTGTACCAGG + Intronic
917227296 1:172799022-172799044 CTGATTATGAGAGGTGAAGCTGG + Intergenic
919415353 1:197301460-197301482 TAAATAATGAGACTTGAAGCCGG - Intronic
924213403 1:241793840-241793862 CATGTTATGAGACATGAAGCAGG - Intronic
1065507091 10:26439455-26439477 CAAATTATGAAACTTGTGCCTGG - Intronic
1067957733 10:50810896-50810918 CAAATATTGAGATGTGTAGTTGG - Intronic
1072926478 10:99620966-99620988 CAAATTCTGAGACGCGTGGCTGG + Intergenic
1076044345 10:127279179-127279201 CAAATTACTAGACTTGTAGGTGG + Intronic
1076292437 10:129357090-129357112 CAAATCCTTAGACGTGGAGCTGG + Intergenic
1087586999 11:100134415-100134437 CAAATTATGACACGGGTGGTAGG + Intronic
1089264432 11:117248691-117248713 GAAATTATGAGGAGTGTACCTGG + Intronic
1090972214 11:131653594-131653616 CAAACTGTGAGATGTTTAGCAGG + Intronic
1095532398 12:43203673-43203695 AAAATTATGAGACATAAAGCAGG + Intergenic
1097806126 12:63966961-63966983 CAACTTATGAGACGTGAATATGG - Intronic
1107651623 13:42550794-42550816 CAAATTATGAGAATCGTAGATGG - Intergenic
1109371815 13:61431659-61431681 GTACTTATGAGACGTGCAGCAGG - Intergenic
1109992394 13:70075113-70075135 CAAATTATGAGACTTGAAGAGGG + Intronic
1115800443 14:36987836-36987858 CAATTTATGCTACCTGTAGCTGG + Intronic
1125026533 15:35036012-35036034 CAATTTAAGAGAATTGTAGCCGG + Intergenic
1126243801 15:46478195-46478217 CAAATTAAGAGACGTGTTCATGG - Intergenic
1133612353 16:7445333-7445355 CAGATTAAGAGAGGAGTAGCGGG - Intronic
1142856519 17:2733553-2733575 AAAATTATGAGAAGAGGAGCTGG - Intergenic
1149558803 17:57593703-57593725 CTAATTAGGACAAGTGTAGCAGG - Intronic
1155174086 18:23287970-23287992 GAAATTATGAGAGCTGTAGAGGG - Intronic
1159033082 18:63251096-63251118 CAAAATATGAGACTTGAAGAAGG + Intronic
1165217924 19:34290026-34290048 CAACTTATGAGAGGTTTATCAGG - Intronic
927834274 2:26379545-26379567 CACATTAGGAGGCATGTAGCGGG + Intronic
929844379 2:45507217-45507239 GAAATTATGAGATGTGTGTCTGG - Intronic
938011368 2:127831558-127831580 CATTTTCTGAGCCGTGTAGCTGG - Intergenic
938415639 2:131101498-131101520 CCAATTATGTGGGGTGTAGCAGG + Intergenic
941631693 2:167891486-167891508 CAAATTTTTACACGTTTAGCTGG + Intergenic
946221912 2:218235003-218235025 CAAATTCTGAGGCATTTAGCAGG + Intronic
1172895842 20:38299462-38299484 CCTTTTATGAGACGTGAAGCTGG + Intronic
961018397 3:123484412-123484434 CAAATTATTAAACATGTTGCTGG + Intergenic
964439280 3:156689194-156689216 CAAATTACCAGACGTACAGCAGG - Intronic
964613990 3:158643021-158643043 CAAATAATCAGACTGGTAGCAGG - Intergenic
970448553 4:16144640-16144662 CAAAATATCACACGTGTTGCGGG + Intergenic
981304175 4:143228773-143228795 CAAATGTTGTGACGTGTATCTGG - Intergenic
981574361 4:146188763-146188785 CAAAGTATGAGACTTTTAACGGG + Intronic
981824052 4:148918913-148918935 CAAATTATGATAGGTTTATCAGG - Intergenic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
996191900 5:120554812-120554834 GAAATTATGAGAGGTGTTTCTGG - Intronic
997706079 5:135953904-135953926 AAAATTATGAAACGTGGAGGAGG + Intronic
999827159 5:155284707-155284729 CAAAATATGAGACTTGAAGAAGG - Intergenic
999909348 5:156180701-156180723 CAAATTATGAGACTTGAAGAGGG + Intronic
1002256321 5:177960975-177960997 CAAATGAGAAGACGTGGAGCAGG + Intergenic
1005720311 6:28595036-28595058 CAAGTTATGAAATGTGTACCTGG + Intronic
1009670416 6:66741407-66741429 CAAAATATGAGACATCGAGCAGG - Intergenic
1009788186 6:68365119-68365141 CAAATTCTGAGAAGTGTATGCGG - Intergenic
1010518718 6:76806593-76806615 CAAAATCTGAGATGTTTAGCAGG - Intergenic
1012340637 6:98118450-98118472 CAAATTAGCAGACGTGTGACTGG - Intergenic
1016642904 6:146370781-146370803 CAAATGAGGGGACGTGTAGATGG - Intronic
1024460914 7:49658539-49658561 CATGTTATGAGATGTGTACCAGG - Intergenic
1028243093 7:88444800-88444822 CAAATTATGGTAAGAGTAGCAGG - Intergenic
1028728948 7:94122652-94122674 AAAATTATGAGACTTTGAGCGGG - Intergenic
1028855884 7:95593421-95593443 CCAATAATGAGATGTGTAGGAGG - Intronic
1051016635 9:12484159-12484181 AAAATTATAAGAATTGTAGCTGG + Intergenic
1052331020 9:27268476-27268498 CAATATATGAAAGGTGTAGCAGG - Intergenic
1055365171 9:75536211-75536233 CAAATTATAAGATGTGTAAAGGG - Intergenic
1057766135 9:97921046-97921068 CAAAATATGAGACCTGTAATCGG + Intronic
1060274309 9:122170794-122170816 AAAATTTTGAGACGTGTTCCAGG + Intronic
1061088309 9:128412044-128412066 CAACTCAGGAGACGTGAAGCTGG + Intronic
1192324278 X:70119006-70119028 CAAATTATGAGACTTGTAGAAGG + Intergenic