ID: 988557788

View in Genome Browser
Species Human (GRCh38)
Location 5:32253064-32253086
Sequence TCCCCTCGTGGGTGGGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 372}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988557788_988557798 -6 Left 988557788 5:32253064-32253086 CCCCCACCCCACCCACGAGGGGA 0: 1
1: 0
2: 3
3: 49
4: 372
Right 988557798 5:32253081-32253103 AGGGGACATTTGGCAATACCTGG 0: 2
1: 48
2: 315
3: 877
4: 1429
988557788_988557799 7 Left 988557788 5:32253064-32253086 CCCCCACCCCACCCACGAGGGGA 0: 1
1: 0
2: 3
3: 49
4: 372
Right 988557799 5:32253094-32253116 CAATACCTGGACATATTTGTTGG 0: 1
1: 0
2: 1
3: 32
4: 462
988557788_988557803 29 Left 988557788 5:32253064-32253086 CCCCCACCCCACCCACGAGGGGA 0: 1
1: 0
2: 3
3: 49
4: 372
Right 988557803 5:32253116-32253138 GTTGTCACAACTCACGGGATAGG 0: 1
1: 0
2: 0
3: 7
4: 84
988557788_988557804 30 Left 988557788 5:32253064-32253086 CCCCCACCCCACCCACGAGGGGA 0: 1
1: 0
2: 3
3: 49
4: 372
Right 988557804 5:32253117-32253139 TTGTCACAACTCACGGGATAGGG 0: 1
1: 0
2: 0
3: 7
4: 76
988557788_988557801 23 Left 988557788 5:32253064-32253086 CCCCCACCCCACCCACGAGGGGA 0: 1
1: 0
2: 3
3: 49
4: 372
Right 988557801 5:32253110-32253132 TTGTTGGTTGTCACAACTCACGG No data
988557788_988557802 24 Left 988557788 5:32253064-32253086 CCCCCACCCCACCCACGAGGGGA 0: 1
1: 0
2: 3
3: 49
4: 372
Right 988557802 5:32253111-32253133 TGTTGGTTGTCACAACTCACGGG 0: 1
1: 0
2: 5
3: 60
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988557788 Original CRISPR TCCCCTCGTGGGTGGGGTGG GGG (reversed) Intronic