ID: 988559745

View in Genome Browser
Species Human (GRCh38)
Location 5:32269784-32269806
Sequence GATCCATTGTTGAGGCCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988559743_988559745 -5 Left 988559743 5:32269766-32269788 CCAAGACACAGCTGTTCTGATCC 0: 1
1: 0
2: 1
3: 14
4: 164
Right 988559745 5:32269784-32269806 GATCCATTGTTGAGGCCTTTAGG 0: 1
1: 0
2: 1
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988559745 Original CRISPR GATCCATTGTTGAGGCCTTT AGG Intronic
905148207 1:35904567-35904589 GATCTATTGTTTTGGCCATTTGG + Intronic
911140876 1:94501290-94501312 GATCCATAATAGAGGCGTTTGGG + Intronic
911900560 1:103497951-103497973 GGTACATGGTTGAGACCTTTAGG - Intergenic
913497227 1:119439513-119439535 GATCCACTGGTGAGGTCTTTAGG - Intergenic
918392404 1:184080052-184080074 GATCCAATGCTGAGTACTTTGGG - Intergenic
920308779 1:205035806-205035828 GATACATAGAAGAGGCCTTTCGG + Intergenic
922150999 1:223004272-223004294 CAACCATTGCTGAGGCCTTCAGG - Exonic
1072662382 10:97370844-97370866 GAGCCACTGTTGAGGCTTGTTGG - Intronic
1074341225 10:112632122-112632144 GAACCTTTGTTGGGGCATTTTGG + Intronic
1080052557 11:27871866-27871888 GATTCAGTGTTGATGCCTATGGG + Intergenic
1082128930 11:48463920-48463942 GATCCATAGATGATGCCTTGAGG - Intergenic
1082248470 11:49953460-49953482 GATCCATAGATGATGCCTTGAGG + Intergenic
1082562475 11:54634896-54634918 GATCCATAGATGATGCCTTGAGG - Intergenic
1086744675 11:90410162-90410184 GATACATTCTTGAGGCCTTTAGG + Intergenic
1086870888 11:92035226-92035248 TATCAATTCTTGATGCCTTTAGG + Intergenic
1088919314 11:114249935-114249957 GAGCCATTCCTGAGGACTTTGGG + Intronic
1091163792 11:133451924-133451946 GAATCATTGTGGAGTCCTTTTGG - Intronic
1093180119 12:15957393-15957415 TGTCCACTGTTGAGGCCCTTAGG + Intronic
1094463443 12:30724033-30724055 AATCTAGTGTTGAGGCTTTTGGG - Intronic
1101743120 12:107516739-107516761 GAGCCTTTGCTGAGGCCTTGTGG + Intronic
1106564460 13:30872471-30872493 GCTGCATAGTTGAGGCCCTTGGG + Intergenic
1109689913 13:65872811-65872833 GATCCATTTTAGAGGCACTTTGG - Intergenic
1109984435 13:69959672-69959694 GATACAATGTTCAGGCCTTTGGG - Intronic
1117652435 14:57920855-57920877 GAGCCATAGCTGAGGCCTCTAGG + Intronic
1126657297 15:50992594-50992616 GATGCCTTGTTTAGGCTTTTTGG + Intronic
1131535782 15:93236606-93236628 GATCCATTGTTGAGGTTGTGTGG + Intergenic
1137815392 16:51393225-51393247 CATCCATTGCTGAGGCCTCCTGG + Intergenic
1142698340 17:1645505-1645527 GAACCGGTGTTGAGGCCGTTAGG - Intronic
1144055778 17:11539279-11539301 CAGCCATTGTTTATGCCTTTGGG + Intronic
1145069586 17:19792355-19792377 AATCCATTCATGAGGGCTTTTGG - Intronic
1150629403 17:66868478-66868500 GCCACATTGTTGAGGCCCTTTGG - Intronic
1151399743 17:73848338-73848360 GAAACATTGATGAGGCCATTAGG - Intergenic
1155847054 18:30721108-30721130 GAGCCATTTCTGAGTCCTTTTGG + Intergenic
1158556246 18:58477124-58477146 GCTCCATGGTTGAGCCCTTCTGG + Intergenic
925802489 2:7614937-7614959 CATCCATCGTTGAAGCATTTAGG + Intergenic
938380150 2:130831991-130832013 GATCCCGTGTGGATGCCTTTAGG - Intergenic
939476584 2:142694989-142695011 GATCCATTGCTGTGGAATTTGGG - Intergenic
942815645 2:180050764-180050786 GACCAATTCTTGAGGCTTTTAGG + Intergenic
943221234 2:185108962-185108984 TATCCATTCTTGTAGCCTTTTGG - Intergenic
1168859467 20:1035578-1035600 CTTCAATTTTTGAGGCCTTTAGG + Intergenic
1170362611 20:15563120-15563142 GATGCAGTGTTGATGCCCTTAGG + Intronic
1172342138 20:34166841-34166863 GATGCATTTTTGAGGCCTACAGG - Intergenic
1175213280 20:57375198-57375220 GCTGCATTTTTGAGGCCTTTGGG + Intronic
1177809332 21:25908615-25908637 GATACATTGTTGAGGCCATAAGG + Intronic
1177868388 21:26540317-26540339 GTTCCATTGATAAGGCTTTTTGG + Intronic
1181549460 22:23628886-23628908 ACTCCATTCTTGAGGCATTTAGG + Intronic
1181799154 22:25333008-25333030 ACTCCATTCTTGAGGCATTTAGG - Intergenic
1181866657 22:25863086-25863108 GATCTGTTGTTGAGTCCCTTTGG + Intronic
1184503837 22:44889430-44889452 GAGCCAGGGTGGAGGCCTTTGGG + Intronic
953122158 3:40055133-40055155 TACCCAGTCTTGAGGCCTTTAGG + Intronic
960388419 3:117049596-117049618 GATGCCATGTTGAGGACTTTGGG + Intronic
964087933 3:152839719-152839741 CATCCATTGTTGGGGCCTTGGGG + Intergenic
969662909 4:8540797-8540819 GGTTCATTGTAGAGGCCTTCAGG + Intergenic
971211608 4:24623165-24623187 TATTCATTGATTAGGCCTTTGGG + Intergenic
976049133 4:80990358-80990380 AATCAAATGTTGATGCCTTTGGG + Intergenic
976889702 4:90031785-90031807 TATTCAGAGTTGAGGCCTTTGGG + Intergenic
978048723 4:104168126-104168148 GATTCATAGATGATGCCTTTGGG + Intergenic
981709613 4:147696058-147696080 TATTCAAAGTTGAGGCCTTTAGG - Intergenic
988559745 5:32269784-32269806 GATCCATTGTTGAGGCCTTTAGG + Intronic
988588626 5:32529831-32529853 GATCCAGTGATGATGGCTTTGGG - Intergenic
995794015 5:115923288-115923310 GATCCATTCTTGATTTCTTTTGG - Intergenic
996510666 5:124312436-124312458 AATCCCTTCCTGAGGCCTTTTGG - Intergenic
997450864 5:133982122-133982144 GCTCCATTGTCGAAGCCCTTGGG - Intronic
1001630145 5:173168862-173168884 GATCCATTGCTGAGGGCATATGG - Intergenic
1005313282 6:24580069-24580091 TCTCCATAGTTGAGGCCTGTAGG - Intronic
1007896908 6:45372050-45372072 TACACATTGTGGAGGCCTTTTGG - Intronic
1013491197 6:110647276-110647298 GTTCCATTGTTGGGGGATTTTGG - Intronic
1014904737 6:127012271-127012293 GGTACTTTGTTGAGGCCCTTAGG + Intergenic
1019149502 6:169994668-169994690 GATCCATTGGGGTGCCCTTTGGG + Intergenic
1023777309 7:43620140-43620162 GATCCATGGTTGAGTGCTTCTGG + Intronic
1036110513 8:5895502-5895524 GATTAATTATTGAGGCTTTTTGG - Intergenic
1044741047 8:95326706-95326728 GCGACATTGTTGAGGCCTCTTGG + Intergenic
1048453880 8:134559667-134559689 GCTCCATTGATGAGGCCATGAGG - Intronic
1055470947 9:76609868-76609890 GATCCAGTGTTAAGGGCTATAGG + Intergenic
1055878059 9:80966843-80966865 TATCCATTGTTCAAGCTTTTTGG - Intergenic
1059586465 9:115612733-115612755 TTTCCATTGTTGAAGCCTGTTGG + Intergenic
1061951304 9:133937784-133937806 GATGCCCTGTTGAGGCCTGTGGG - Intronic
1189738709 X:44097098-44097120 GATCCACTGGTGTGGCCTTTTGG + Intergenic
1193637841 X:83974779-83974801 CATCCATACTTGAGTCCTTTTGG - Intergenic
1195850157 X:109273917-109273939 GGTCCTTTGCTGGGGCCTTTGGG + Intergenic
1197167236 X:123391805-123391827 CAGCCATTCTTGAGGCCTGTAGG + Intronic
1198495006 X:137183531-137183553 GTTCCATTTTTGAGGCTTTAAGG + Intergenic
1199180649 X:144849641-144849663 GAACAATTGTTGTGGTCTTTTGG - Intergenic