ID: 988563072

View in Genome Browser
Species Human (GRCh38)
Location 5:32298278-32298300
Sequence ACCACAGAGGGCCCCACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988563064_988563072 23 Left 988563064 5:32298232-32298254 CCAGGAGATGCTAGACAGAAGGT 0: 1
1: 0
2: 2
3: 13
4: 124
Right 988563072 5:32298278-32298300 ACCACAGAGGGCCCCACAAAGGG 0: 1
1: 0
2: 3
3: 22
4: 162
988563068_988563072 -2 Left 988563068 5:32298257-32298279 CCATGGAAACACAGACGGATCAC 0: 1
1: 0
2: 0
3: 12
4: 107
Right 988563072 5:32298278-32298300 ACCACAGAGGGCCCCACAAAGGG 0: 1
1: 0
2: 3
3: 22
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988563072 Original CRISPR ACCACAGAGGGCCCCACAAA GGG Intronic
900409857 1:2507621-2507643 ACCACAGTGGGGGCCAGAAATGG + Intergenic
901400169 1:9010317-9010339 ACCTAAGAGGGGCCCACAAAAGG - Intronic
901514463 1:9735674-9735696 ACCACAGATGCCTCCACAAAGGG + Intronic
901624219 1:10614541-10614563 AGCCCAGAGGGCCCCAGAGAAGG + Intronic
905479939 1:38254714-38254736 ACTACAGAGGGCCTCCCAGAGGG + Intergenic
905949714 1:41939269-41939291 ACCAAAGAGGGACACACAGAGGG - Intronic
906509765 1:46404370-46404392 ACCACACAGGGTCCTACAGAAGG - Intronic
906852971 1:49271809-49271831 AAAATAGAAGGCCCCACAAATGG - Intronic
910648193 1:89535982-89536004 AACCCAGAGGGCCCCAGGAAAGG - Intronic
912096155 1:106147336-106147358 TCCATAGTGGTCCCCACAAAAGG - Intergenic
912121114 1:106473248-106473270 GCCACGGATGGCCCCACTAAGGG + Intergenic
916691779 1:167196855-167196877 ACCACAGAGCCCCCCAGAAAGGG + Intergenic
919381523 1:196867151-196867173 AACACAGAAGGCCCCAGCAAAGG - Intronic
923508106 1:234624196-234624218 TCCACTGAGGTCCCCAGAAAGGG - Intergenic
1064694010 10:17947914-17947936 GCCAGAGAAGGCCCCACAAGAGG + Intergenic
1065688497 10:28309520-28309542 CCCACAGAGGGTCTCACCAAGGG - Intronic
1066470537 10:35693425-35693447 ACTACTGAGGGCCCCAGAACTGG - Intergenic
1069571083 10:69494859-69494881 AGCACAAAGGGCCCCACAGTGGG - Intronic
1069710762 10:70487009-70487031 TCCCCAGAGGGCTCCCCAAAGGG - Intronic
1070549053 10:77476284-77476306 AACAAAGATGGCCCCAGAAAGGG + Intronic
1070615735 10:77967976-77967998 CCCAAAGAGGGCCCCTCACAGGG - Intergenic
1071183047 10:83009068-83009090 ACCACAGAGTGCCACAGAAAAGG + Intergenic
1076978822 11:194597-194619 CCCACAGAGGGGCACACAAATGG + Intronic
1076978842 11:194707-194729 CCCACAGAGGGACACACAAATGG + Intronic
1076978861 11:194814-194836 CCCACAGAGGGACACACAAATGG + Intronic
1076978879 11:194920-194942 CCCACAGAGGTACACACAAATGG + Intronic
1077087856 11:763516-763538 ACCACAGAGGGACCCTCACCAGG - Exonic
1077267654 11:1660012-1660034 GCCACTGAGGTGCCCACAAAGGG + Intergenic
1077439616 11:2561886-2561908 GACACAGAGGGCCCCACTCAAGG + Intronic
1080210146 11:29776648-29776670 ACCACTGAAGACCCCAAAAAGGG + Intergenic
1081859362 11:46323769-46323791 GCTACAGAGGGCCTCACAAGCGG + Intergenic
1083897830 11:65629023-65629045 CCCACAGAGGGGCCCACAGCAGG + Intronic
1083925633 11:65804328-65804350 CCCACAGAGGTCCCTACACAAGG - Intergenic
1086827485 11:91517650-91517672 TCCACAGTGGCACCCACAAAAGG + Intergenic
1090835794 11:130452559-130452581 ACCACAAAGGGTCACCCAAACGG - Intronic
1091311677 11:134579514-134579536 CCCACAGAGGCCCCTGCAAAGGG - Intergenic
1092246349 12:6866471-6866493 ACCACACAGGGGCAAACAAAGGG - Exonic
1101751993 12:107589559-107589581 ACCAGAGAGGGGCTCACTAATGG + Intronic
1103976087 12:124703658-124703680 ATCACACAGGGCCCTATAAAAGG + Intergenic
1104608484 12:130207167-130207189 ATCACAGAGGGCCCCTGATATGG + Intergenic
1106742191 13:32656483-32656505 ACCACAGATGACACAACAAATGG - Intronic
1108213568 13:48161659-48161681 AACACCAAGGACCCCACAAAGGG + Intergenic
1108578770 13:51811250-51811272 ACCAAGGCGGCCCCCACAAAAGG + Intergenic
1108792530 13:53989094-53989116 AACAGAGAGACCCCCACAAACGG + Intergenic
1110132137 13:72022001-72022023 GCCACAATGGGCACCACAAATGG + Intergenic
1110242312 13:73282794-73282816 ACCACAGTGGTCTCCACAAATGG - Intergenic
1110674889 13:78230300-78230322 CTCTCAGAGGCCCCCACAAAAGG - Intergenic
1111577557 13:90176139-90176161 AAGACAGAGGGGCCCACGAAAGG - Intergenic
1111648393 13:91060731-91060753 AAGACAGAAGGCCCCAAAAAGGG + Intergenic
1112251384 13:97783780-97783802 ACAACAGAGAGCCCCCAAAAGGG + Intergenic
1112562714 13:100528371-100528393 ACCACAACGGCCCTCACAAAAGG - Intronic
1114337781 14:21710639-21710661 AACACAGAGGGGAACACAAAAGG - Intergenic
1114577210 14:23725963-23725985 CCCAAACAGGGCCCCACACAGGG + Intergenic
1115753398 14:36512542-36512564 ACCAAATTGGGCCCCACAGAGGG + Intronic
1118315745 14:64725135-64725157 CCCAGAGAGGGACCCTCAAAAGG + Intronic
1118808627 14:69258383-69258405 CACAAAGAGGGCCTCACAAAGGG - Intergenic
1119634314 14:76261679-76261701 ACCACAGAGGCAGCCCCAAAGGG - Intergenic
1122017764 14:98810703-98810725 CCCACAGAGGACTCAACAAATGG - Intergenic
1124570941 15:30863310-30863332 ACCACAGAGGGCTCTAGCAAAGG - Intergenic
1128137659 15:65275951-65275973 GGCCCAGAGAGCCCCACAAAAGG + Intronic
1130011202 15:80154041-80154063 ACCGCAGACAGGCCCACAAAAGG - Intronic
1132972823 16:2697207-2697229 ACCCCAGAGGAACCCACATATGG - Intronic
1138249066 16:55488626-55488648 ACCACTGAGGGCCGCACGGATGG + Exonic
1138532761 16:57643746-57643768 ACCACAGAGAGCTCCCCAAGAGG - Intronic
1139463552 16:67141801-67141823 ACCACACAGAGCCCCAAACAGGG + Intronic
1140401425 16:74674962-74674984 TCCACAGAGGGCCGCACAGAGGG + Exonic
1142146549 16:88495208-88495230 ACCACACAGGGCCCGTGAAATGG - Intronic
1142184589 16:88688533-88688555 ACCCAAGAAGGCCCCACAGAGGG + Intergenic
1142466252 17:139089-139111 CCCACAGAGGGGCACACAAATGG + Intergenic
1142466270 17:139199-139221 CCCACAGAGGGACACACAAATGG + Intergenic
1142466289 17:139306-139328 CCCACAGAGGGACACACAAATGG + Intergenic
1142466309 17:139412-139434 CCCACAGAGGGGCACACAAGTGG + Intergenic
1142466329 17:139518-139540 CCCACAGAGGGGCACACAAATGG + Intergenic
1142466348 17:139628-139650 CCCACAGAGGGGCACACAAATGG + Intergenic
1142466369 17:139738-139760 CCCACAGAGGGGCACACAAGTGG + Intergenic
1143178640 17:4970696-4970718 AGCACAGAGGGACCCCCAAGTGG - Intronic
1143580777 17:7824402-7824424 TCTACAGAGGGCCCCAGAAGTGG + Intronic
1144377282 17:14657102-14657124 CCCACCGAGGGACCCACACAGGG - Intergenic
1144589998 17:16515702-16515724 CCCACAGAGACACCCACAAAGGG - Intergenic
1144947805 17:18978671-18978693 ACCACAGAGGGCAGCACAATAGG + Exonic
1144961950 17:19049411-19049433 ACCAGAGAGGACCCCACAAATGG + Intergenic
1144973211 17:19125111-19125133 ACCAGAGAGGACCCCACAAATGG - Intergenic
1146950466 17:36901787-36901809 TCTACAGAAGGCCCCACACAGGG + Intergenic
1147867783 17:43564932-43564954 ACCTCAGAGAGCCTCACATAGGG + Intronic
1148766826 17:50044383-50044405 ATCACAGAGGACCCCAGAAAAGG - Intergenic
1149398478 17:56269814-56269836 AGAACAGAGGGCCCCAAACACGG - Intronic
1151562125 17:74876159-74876181 ACCACAGAGGGGCTCTCCAACGG + Intergenic
1153016239 18:584780-584802 TCCACAGAGGTGCCCACTAAGGG - Intergenic
1155557788 18:27040479-27040501 AAAACAGAGAGACCCACAAAGGG - Intronic
1157544504 18:48538783-48538805 ACCGCAGAGGCCCCCACCCAGGG + Intergenic
1157576303 18:48746146-48746168 AGCAAAGATGGCCCCACAGATGG - Intronic
1157617255 18:48994551-48994573 CCCACACACGGCCTCACAAATGG + Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1165095950 19:33410050-33410072 ACCACAGTGAGCCCCACAAATGG - Intronic
1167932281 19:52875668-52875690 ACCACAGTCAGCCCCTCAAATGG - Intronic
928606074 2:32946571-32946593 ACCAAATCGGGCCCCAGAAAGGG - Intergenic
933833612 2:86229376-86229398 AGCAGAAAGGGCCCCAGAAAAGG - Intronic
934553992 2:95277921-95277943 TCCACAGAGGGCACCTGAAATGG - Exonic
934983927 2:98870476-98870498 AGCACAGTGGGCTGCACAAAGGG - Intronic
935262472 2:101367192-101367214 ACAACAGATGGCACCAGAAAAGG + Intronic
937972517 2:127561586-127561608 AGCACAGAGGGCACCACAGAGGG - Intronic
938369856 2:130762257-130762279 ACGACAGATGCCCCAACAAAGGG + Exonic
939996661 2:148926504-148926526 CCCACAGAAGCGCCCACAAAAGG - Intronic
941384129 2:164832754-164832776 ACTACAAATGGCCCAACAAATGG + Intronic
947166229 2:227264668-227264690 ACCACACCTGGCCCCAGAAAAGG - Intronic
948300377 2:236901997-236902019 ACCACAGACGTCTACACAAATGG + Intergenic
948499149 2:238378977-238378999 CCCACAGAGGGCACCAAAGAAGG - Intronic
1169550499 20:6697025-6697047 ACAACAAAGGACACCACAAAAGG - Intergenic
1170906467 20:20519445-20519467 TCCACTAAGGGCCTCACAAAAGG + Intronic
1170944755 20:20881316-20881338 CCCACAGAGGGAGCCACAGAAGG - Intergenic
1172106188 20:32518582-32518604 ACCCCAGAGCAGCCCACAAATGG + Intronic
1172179403 20:32991974-32991996 CCCACACAGGGCCCCTCAACTGG - Intronic
1174152825 20:48498055-48498077 ACCACAGAGAGCTGCAGAAAGGG + Intergenic
1176097712 20:63351974-63351996 CCCACAGAAGTCCCCACCAATGG + Intronic
1179410514 21:41159478-41159500 ACCACAGTGTCCCCCACAGAAGG - Intergenic
1179425651 21:41276182-41276204 AGCACAGAGAAACCCACAAAAGG - Exonic
1180052969 21:45341352-45341374 ACCACTGAGCCCCCCACAGAAGG + Intergenic
1180107917 21:45631950-45631972 ACAAAAGAGGGCCCCACACATGG - Intergenic
1180130225 21:45822312-45822334 ACCGGAGAAGGCCCCAGAAAAGG - Intronic
1181378898 22:22483555-22483577 ACCACACCTGGCCCCAAAAATGG + Intergenic
1182305866 22:29367681-29367703 AGCAAAGTGGGTCCCACAAAGGG - Intronic
1182310265 22:29399724-29399746 ACCACAAAAGGGGCCACAAAAGG - Intronic
1182313133 22:29423597-29423619 AGCAAAGTGGGTCCCACAAAGGG - Intergenic
1183719051 22:39551630-39551652 GCCAAAGAAGGCTCCACAAAGGG - Intergenic
1184720279 22:46308695-46308717 CCCACAGGGGGCCCCAGCAAGGG - Exonic
950687002 3:14625874-14625896 TCCACAGGGGGCTCCACAAAGGG + Intergenic
951425728 3:22543058-22543080 ATGACAGAGGTCCTCACAAAGGG - Intergenic
953526350 3:43692752-43692774 ACCTCAAAGGGTTCCACAAAGGG - Intronic
954100946 3:48372179-48372201 TCCACAGAGGTCCGCCCAAAGGG - Intergenic
957040020 3:75329430-75329452 ACCACAGAGGCCCTCACAGCTGG + Intergenic
957041591 3:75340086-75340108 ACTACTGAGGGCACCACAACAGG + Intergenic
962265833 3:133943732-133943754 ACCACAGAAGCCACCACAACTGG + Intronic
965622574 3:170655880-170655902 ACCACAAAGGGCCCCTTGAATGG + Intronic
967121013 3:186383077-186383099 AGCACAAAAGACCCCACAAAGGG - Intergenic
967994990 3:195159780-195159802 ACCACAGAGGGCCACATGCACGG + Intronic
968137414 3:196229005-196229027 TTGACAGAGGGCCCCAGAAAAGG + Intronic
968864292 4:3197934-3197956 GGAACAGAGGGCCCCACAGAAGG + Intronic
969202389 4:5616286-5616308 AGCTCAGAGGGCCACAGAAAGGG + Intronic
969589930 4:8115979-8116001 ACCACAGAAGTCCCCACGGATGG + Intronic
972696633 4:41452778-41452800 ACAACAGAGGACCCCAAAAAAGG - Intronic
973713877 4:53655867-53655889 ACCACAGAATGCACCACTAATGG + Intronic
974169806 4:58251647-58251669 AACCCAGGGGTCCCCACAAAAGG - Intergenic
981178991 4:141716601-141716623 ACCACAGAGAGCCCCCAACAGGG + Intronic
982243840 4:153328880-153328902 ACCCCACAGACCCCCACAAAGGG + Intronic
983634321 4:169882309-169882331 ACCACAGAGAGCCCCAGCAAGGG + Intergenic
984178394 4:176449634-176449656 ATAACAGAGAGCCCCTCAAATGG - Intergenic
985476009 5:79500-79522 GCCACAGAGGGGCCCTCAGAAGG - Intergenic
988563072 5:32298278-32298300 ACCACAGAGGGCCCCACAAAGGG + Intronic
990608470 5:57434060-57434082 ATTACAGAGGTCTCCACAAATGG - Intergenic
992251118 5:74876733-74876755 ACCAGAGAGGGCACAAGAAAAGG + Intergenic
993202179 5:84830394-84830416 CCCACAGTGGGCTCCCCAAACGG - Intergenic
995532356 5:113104155-113104177 ACCTCAAAGGGCCTCACAGAGGG + Intronic
998457927 5:142287969-142287991 ACCACAGAGGGGCAGACAAGAGG + Intergenic
1000216854 5:159166642-159166664 ACCACAGACTGACCCACATATGG - Intronic
1001210775 5:169808296-169808318 AACACACAGCGCCCCCCAAATGG - Intronic
1001791653 5:174462799-174462821 TCCACAGAGGAACCCACATAAGG - Intergenic
1002107803 5:176888777-176888799 ACCAAAGAGGACCCCACACCGGG + Exonic
1002836762 6:871165-871187 TCCCCACAGGGCCCCACAAGGGG + Intergenic
1003889131 6:10548344-10548366 CCCAGAAAGGGCACCACAAAAGG + Intronic
1005344396 6:24875127-24875149 AGCACATAGGGCCCCTCAGAGGG + Intronic
1014730509 6:125025992-125026014 ACCCCAGAGGGTCCCAGAGAAGG + Intronic
1015091771 6:129366852-129366874 ACCAGAGAGCCCCCTACAAAGGG + Intronic
1016244058 6:141962238-141962260 ACCTCAGAGGGCCACACATTTGG + Intergenic
1021080479 7:16358178-16358200 ACCACCGAGTGCCACACACATGG + Intronic
1021342380 7:19480464-19480486 ACCACAGAGAGCCCCTGACAGGG + Intergenic
1024367298 7:48535665-48535687 ACCACAGCAAGCCCCACCAAAGG - Intronic
1026651980 7:72223587-72223609 CCCTCACAGGCCCCCACAAAAGG + Intronic
1028621202 7:92831549-92831571 ATCACAAAGAGCCCCAAAAACGG + Intronic
1029656499 7:101928651-101928673 ACCACACCCGGCCTCACAAATGG + Intronic
1031063997 7:117084358-117084380 ACCACTGAGGGCAACACAGATGG + Intronic
1034804953 7:154081212-154081234 CCCACAGAGGGCCTCACTACAGG - Intronic
1035897638 8:3421963-3421985 ACCACAACCGGCCCCACAGATGG + Intronic
1039443510 8:37612084-37612106 AAAACACAGTGCCCCACAAAGGG + Intergenic
1045188248 8:99859075-99859097 TCCTCTGACGGCCCCACAAATGG - Intronic
1048049116 8:130800584-130800606 CACACAGAGGGCACCAGAAATGG + Intronic
1048908697 8:139113511-139113533 ACCACACAGGGACCTACAACTGG - Intergenic
1049170856 8:141159825-141159847 ACCCCAGAGGGCCTCACTCAGGG - Intronic
1050077280 9:1878133-1878155 ACAACAGAGGGCACCAAAATTGG - Intergenic
1054791455 9:69260344-69260366 AGCACAGAGGGGCCCACCATAGG + Intergenic
1057859036 9:98625133-98625155 GCAGCAGAGGGCCCCACAAAGGG + Intronic
1061059507 9:128243494-128243516 ACGACAGAGGGCCCCTCCCAAGG - Intronic
1061252090 9:129432397-129432419 CCCACAGAGACCCCCACAGAGGG - Intergenic
1191249955 X:58255540-58255562 ACCCCAGAGGGCCCAGCACAGGG + Intergenic
1196179736 X:112676849-112676871 ACCTCTGAGGACCCAACAAAAGG - Intronic