ID: 988564194

View in Genome Browser
Species Human (GRCh38)
Location 5:32308025-32308047
Sequence AGAAATAAGCAACAGTTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988564190_988564194 -8 Left 988564190 5:32308010-32308032 CCAAAACCCATATGAAGAAATAA 0: 1
1: 1
2: 9
3: 73
4: 807
Right 988564194 5:32308025-32308047 AGAAATAAGCAACAGTTGGCTGG No data
988564189_988564194 -1 Left 988564189 5:32308003-32308025 CCAGCTACCAAAACCCATATGAA 0: 1
1: 0
2: 0
3: 9
4: 139
Right 988564194 5:32308025-32308047 AGAAATAAGCAACAGTTGGCTGG No data
988564188_988564194 0 Left 988564188 5:32308002-32308024 CCCAGCTACCAAAACCCATATGA 0: 1
1: 0
2: 0
3: 7
4: 107
Right 988564194 5:32308025-32308047 AGAAATAAGCAACAGTTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988564194 Original CRISPR AGAAATAAGCAACAGTTGGC TGG Intronic
No off target data available for this crispr