ID: 988567973

View in Genome Browser
Species Human (GRCh38)
Location 5:32335467-32335489
Sequence TTTGTTAGGTTCTTTTCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988567973_988567977 10 Left 988567973 5:32335467-32335489 CCGTGGGAAAAGAACCTAACAAA No data
Right 988567977 5:32335500-32335522 TTAGGAGAGTGAAGGCCTCTTGG No data
988567973_988567975 -8 Left 988567973 5:32335467-32335489 CCGTGGGAAAAGAACCTAACAAA No data
Right 988567975 5:32335482-32335504 CTAACAAATGATGTATTTTTAGG No data
988567973_988567976 2 Left 988567973 5:32335467-32335489 CCGTGGGAAAAGAACCTAACAAA No data
Right 988567976 5:32335492-32335514 ATGTATTTTTAGGAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988567973 Original CRISPR TTTGTTAGGTTCTTTTCCCA CGG (reversed) Intergenic
No off target data available for this crispr