ID: 988567976

View in Genome Browser
Species Human (GRCh38)
Location 5:32335492-32335514
Sequence ATGTATTTTTAGGAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988567973_988567976 2 Left 988567973 5:32335467-32335489 CCGTGGGAAAAGAACCTAACAAA No data
Right 988567976 5:32335492-32335514 ATGTATTTTTAGGAGAGTGAAGG No data
988567972_988567976 7 Left 988567972 5:32335462-32335484 CCAAACCGTGGGAAAAGAACCTA No data
Right 988567976 5:32335492-32335514 ATGTATTTTTAGGAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988567976 Original CRISPR ATGTATTTTTAGGAGAGTGA AGG Intergenic
No off target data available for this crispr