ID: 988570239

View in Genome Browser
Species Human (GRCh38)
Location 5:32358112-32358134
Sequence CTCTGGAAGGCCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122708
Summary {0: 2, 1: 107, 2: 3062, 3: 31028, 4: 88509}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988570235_988570239 -8 Left 988570235 5:32358097-32358119 CCTGTAATCTCAGCACTCTGGAA 0: 23
1: 1508
2: 36680
3: 331169
4: 252371
Right 988570239 5:32358112-32358134 CTCTGGAAGGCCAAGGTGGAAGG 0: 2
1: 107
2: 3062
3: 31028
4: 88509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988570239 Original CRISPR CTCTGGAAGGCCAAGGTGGA AGG Intronic
Too many off-targets to display for this crispr