ID: 988577843

View in Genome Browser
Species Human (GRCh38)
Location 5:32444257-32444279
Sequence TGGATTCACCCACAGCGGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 76}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988577843_988577852 19 Left 988577843 5:32444257-32444279 CCGCCCCGCTGTGGGTGAATCCA 0: 1
1: 0
2: 1
3: 5
4: 76
Right 988577852 5:32444299-32444321 TTTTGGCATCTTCCCCCAGCCGG 0: 1
1: 0
2: 2
3: 63
4: 1011
988577843_988577849 2 Left 988577843 5:32444257-32444279 CCGCCCCGCTGTGGGTGAATCCA 0: 1
1: 0
2: 1
3: 5
4: 76
Right 988577849 5:32444282-32444304 GTAGTTGCCGGTCGCCATTTTGG 0: 1
1: 0
2: 0
3: 3
4: 35
988577843_988577854 24 Left 988577843 5:32444257-32444279 CCGCCCCGCTGTGGGTGAATCCA 0: 1
1: 0
2: 1
3: 5
4: 76
Right 988577854 5:32444304-32444326 GCATCTTCCCCCAGCCGGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 111
988577843_988577853 23 Left 988577843 5:32444257-32444279 CCGCCCCGCTGTGGGTGAATCCA 0: 1
1: 0
2: 1
3: 5
4: 76
Right 988577853 5:32444303-32444325 GGCATCTTCCCCCAGCCGGCTGG 0: 1
1: 1
2: 0
3: 20
4: 139
988577843_988577847 -10 Left 988577843 5:32444257-32444279 CCGCCCCGCTGTGGGTGAATCCA 0: 1
1: 0
2: 1
3: 5
4: 76
Right 988577847 5:32444270-32444292 GGTGAATCCAAAGTAGTTGCCGG 0: 1
1: 0
2: 1
3: 9
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988577843 Original CRISPR TGGATTCACCCACAGCGGGG CGG (reversed) Exonic
900213523 1:1468745-1468767 AGGATTTAACCACAGAGGGGTGG + Exonic
900221085 1:1509561-1509583 AGGATTTAACCACAGAGGGGTGG + Intergenic
908842540 1:68294215-68294237 CCCATTCACACACAGCGGGGCGG - Intergenic
914747722 1:150511921-150511943 TGGACGCACTCACAGCAGGGGGG - Intronic
1063187937 10:3667092-3667114 TGGGTGCAACCACAGCGGCGTGG + Intergenic
1063975009 10:11408091-11408113 TGGGTTCACACACAGAGGGTGGG + Intergenic
1064877495 10:20011311-20011333 TGGATGCACCCACAGAGGGACGG + Intronic
1066681261 10:37938553-37938575 CAGATTCATCCACAGCAGGGAGG - Intergenic
1077251486 11:1562825-1562847 TGGTCTCACCCACAGAGAGGTGG + Intronic
1079720428 11:23805027-23805049 TGCATTCACACACAGAGTGGTGG + Intergenic
1083195146 11:61081578-61081600 TAGATTCACTCACAACTGGGGGG + Intergenic
1085146817 11:74207700-74207722 TGGATTCTCCCACAGCAGCTAGG - Intronic
1089348765 11:117809337-117809359 AGGAGTCAGGCACAGCGGGGAGG - Intronic
1090299252 11:125620682-125620704 TGGATTCACCCAGAGTGGGCAGG - Intronic
1090396572 11:126423304-126423326 TGAATCCACCCACAGGGGAGAGG + Intronic
1091704528 12:2684899-2684921 TGGAGTCACCCTCAGAGGTGTGG + Intronic
1101922523 12:108944335-108944357 TGGATTCATCCACATCAGTGTGG + Intronic
1103955275 12:124572902-124572924 GGGAATCACCCACAGCTGAGTGG - Intergenic
1104111718 12:125710708-125710730 GGGGTTCACTCACAGCAGGGAGG - Intergenic
1104670944 12:130679817-130679839 TGTGTTCACCCACCGCGGGAAGG + Intronic
1104670960 12:130679915-130679937 TGTGTTCACCCACCGCGGGAAGG + Intronic
1105942450 13:25161125-25161147 TGGATGCATCCACAGTAGGGTGG - Intergenic
1113868323 13:113543318-113543340 TGGAGTCACCCACAGAGGGAGGG - Intronic
1119438621 14:74613347-74613369 TGGATTCAGCCAGAGGCGGGAGG - Intergenic
1119623570 14:76151790-76151812 TGGCTCCGCCCACCGCGGGGCGG + Intergenic
1121825773 14:97008408-97008430 TGGATTCACCCACCCCAGGCAGG + Intergenic
1124937605 15:34187004-34187026 TGGGCTCAGCCACAGCAGGGCGG + Intronic
1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG + Intronic
1133890138 16:9871168-9871190 TGGATTGACTCAGAGCTGGGTGG - Intronic
1139649605 16:68355760-68355782 TGGGTACTCCCACAGCGGGTGGG - Exonic
1140615300 16:76655907-76655929 TGGATTCCCTCACTGAGGGGTGG + Intergenic
1141858080 16:86698295-86698317 TGGATGCCCCCACAGCTGGAGGG - Intergenic
1148478034 17:47941865-47941887 CGGAGTCATCTACAGCGGGGAGG + Intronic
1149513980 17:57266154-57266176 TGCCTTCAGTCACAGCGGGGTGG + Intronic
1154393937 18:13970047-13970069 TGGACTCACCCATAGATGGGTGG + Intergenic
1158984469 18:62800185-62800207 TGGATTCAGCCAGTGGGGGGTGG - Intronic
1159699703 18:71609593-71609615 TGCATTCTCCCTCAGTGGGGTGG - Intergenic
1160609589 18:80075040-80075062 TGGAATCACACACAGCAGAGTGG - Intronic
1163645542 19:18487036-18487058 AGGATTTACCCACTGCGTGGTGG - Intronic
1164097846 19:22027781-22027803 TGGATCCAGCCACAGGTGGGAGG - Intergenic
1164200806 19:23016798-23016820 TGGATCCAACCACAGGTGGGAGG - Intergenic
1166255137 19:41599015-41599037 TGGATTTACTCCCAGCAGGGAGG - Intronic
1167899196 19:52605794-52605816 TGGAACAACCCAAAGCGGGGTGG - Intronic
925188301 2:1864347-1864369 TGGATGCACCCATGGCAGGGAGG - Intronic
925894066 2:8457731-8457753 TGGGTTCACCCACCGCGGGGAGG - Intergenic
945515007 2:210752706-210752728 TGGATTTACTCTCAGCGAGGTGG - Intergenic
1172588687 20:36102656-36102678 TGGCTTCACCCACCACTGGGGGG + Intronic
1179803055 21:43820652-43820674 TAGAGTCACCCGAAGCGGGGAGG + Intergenic
1184856707 22:47150306-47150328 TGGCTGCACTCACAGTGGGGTGG + Intronic
960369389 3:116815220-116815242 TGGATTGACCCACAGGATGGAGG + Intronic
961674345 3:128555646-128555668 TGGAGTCACCCCCAGCGCTGAGG - Intergenic
963314797 3:143747547-143747569 TGAATACACCCACAGAGTGGGGG + Intronic
967272385 3:187742178-187742200 TAGTTTCACCCACCGAGGGGTGG + Intronic
969289415 4:6229181-6229203 TGTATTCACGCAAAGCGAGGGGG + Intergenic
976604087 4:86966471-86966493 TGGAATCACCCACTGGGGGATGG - Intronic
977670893 4:99693551-99693573 TGCATTCACCCACAGCCTAGAGG + Intergenic
984687043 4:182680647-182680669 TGTATTGACCCACAGTGTGGGGG + Exonic
988577843 5:32444257-32444279 TGGATTCACCCACAGCGGGGCGG - Exonic
996552801 5:124747641-124747663 TAGCTTCGCCCACTGCGGGGGGG - Intronic
1002721857 5:181266029-181266051 TGGACTGGCCCACACCGGGGAGG - Intergenic
1015426020 6:133068331-133068353 TGGACTCACCCTCACTGGGGCGG + Intergenic
1016136817 6:140554518-140554540 TGGACCCACCCACAGCCTGGGGG - Intergenic
1018939043 6:168296106-168296128 TGGATCCATCCACAGCGGTGAGG + Intronic
1018939091 6:168296371-168296393 CGGATCCATCCACAGCGGTGAGG + Intronic
1018939105 6:168296435-168296457 CGGATCCATCCACAGCGGTGAGG + Intronic
1018939130 6:168296572-168296594 TGGATCCATCCACAGCGGTGAGG + Intronic
1021679713 7:23117847-23117869 TAGATTCAACTACAGCTGGGTGG - Intronic
1031080792 7:117255195-117255217 TGTATTCCCCCACAGAGGAGGGG + Intergenic
1033538486 7:142333919-142333941 TAGCTTCACCCACAGAGAGGTGG + Intergenic
1034664500 7:152804724-152804746 TGGATTTTCCCTCAGCGTGGAGG + Intronic
1035340490 7:158157643-158157665 TGGATGCGCCCAGTGCGGGGTGG - Intronic
1035382367 7:158448036-158448058 TGGCTTCACCCTCAGCAGTGAGG - Intronic
1037561064 8:20074762-20074784 TGGATGCAATCACAGCGGTGTGG + Intergenic
1041176545 8:55202936-55202958 TGGATCCAGCCACAGCTGGAGGG + Intronic
1047411036 8:124624790-124624812 TGGATTTGCGCAGAGCGGGGAGG + Intronic
1049276592 8:141723136-141723158 TGGATTCAGCCCCAGAGGGACGG + Intergenic
1049540892 8:143208279-143208301 GGCACTCACCCACAGCGGCGGGG - Intergenic
1061040517 9:128138688-128138710 GGGATTCACCCCCCGCGAGGCGG - Intergenic
1191590985 X:62884800-62884822 TTGATTCACTCACAGTTGGGTGG - Intergenic
1193409088 X:81141210-81141232 TGGATTCACCCAGTGCCTGGGGG + Intronic
1194916062 X:99710493-99710515 TGTCTTCCCTCACAGCGGGGTGG - Intergenic
1198066725 X:133105341-133105363 TGAGTTCACCCACACTGGGGAGG - Intergenic
1199374169 X:147087983-147088005 TGGATCCACCCAGGGCTGGGGGG - Intergenic