ID: 988577964 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:32444706-32444728 |
| Sequence | GAGGAGGAGCGGGGCAGAGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2424 | |||
| Summary | {0: 1, 1: 1, 2: 10, 3: 271, 4: 2141} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 988577964_988577974 | 17 | Left | 988577964 | 5:32444706-32444728 | CCTCCTCTGCCCCGCTCCTCCTC | 0: 1 1: 1 2: 10 3: 271 4: 2141 |
||
| Right | 988577974 | 5:32444746-32444768 | CGCCTCCGACCGCACTGCGCAGG | 0: 1 1: 0 2: 0 3: 2 4: 64 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 988577964 | Original CRISPR | GAGGAGGAGCGGGGCAGAGG AGG (reversed) | Exonic | ||