ID: 988577968

View in Genome Browser
Species Human (GRCh38)
Location 5:32444716-32444738
Sequence GTTCTCCGCTGAGGAGGAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988577968_988577979 30 Left 988577968 5:32444716-32444738 CCCGCTCCTCCTCAGCGGAGAAC 0: 1
1: 0
2: 2
3: 22
4: 176
Right 988577979 5:32444769-32444791 CGCGCCTGTGCTCGGCATCCTGG 0: 1
1: 0
2: 0
3: 2
4: 111
988577968_988577978 22 Left 988577968 5:32444716-32444738 CCCGCTCCTCCTCAGCGGAGAAC 0: 1
1: 0
2: 2
3: 22
4: 176
Right 988577978 5:32444761-32444783 TGCGCAGGCGCGCCTGTGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 98
988577968_988577974 7 Left 988577968 5:32444716-32444738 CCCGCTCCTCCTCAGCGGAGAAC 0: 1
1: 0
2: 2
3: 22
4: 176
Right 988577974 5:32444746-32444768 CGCCTCCGACCGCACTGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988577968 Original CRISPR GTTCTCCGCTGAGGAGGAGC GGG (reversed) Exonic