ID: 988577969

View in Genome Browser
Species Human (GRCh38)
Location 5:32444717-32444739
Sequence TGTTCTCCGCTGAGGAGGAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 370}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988577969_988577980 30 Left 988577969 5:32444717-32444739 CCGCTCCTCCTCAGCGGAGAACA 0: 1
1: 0
2: 2
3: 22
4: 370
Right 988577980 5:32444770-32444792 GCGCCTGTGCTCGGCATCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 183
988577969_988577974 6 Left 988577969 5:32444717-32444739 CCGCTCCTCCTCAGCGGAGAACA 0: 1
1: 0
2: 2
3: 22
4: 370
Right 988577974 5:32444746-32444768 CGCCTCCGACCGCACTGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 64
988577969_988577978 21 Left 988577969 5:32444717-32444739 CCGCTCCTCCTCAGCGGAGAACA 0: 1
1: 0
2: 2
3: 22
4: 370
Right 988577978 5:32444761-32444783 TGCGCAGGCGCGCCTGTGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 98
988577969_988577979 29 Left 988577969 5:32444717-32444739 CCGCTCCTCCTCAGCGGAGAACA 0: 1
1: 0
2: 2
3: 22
4: 370
Right 988577979 5:32444769-32444791 CGCGCCTGTGCTCGGCATCCTGG 0: 1
1: 0
2: 0
3: 2
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988577969 Original CRISPR TGTTCTCCGCTGAGGAGGAG CGG (reversed) Exonic