ID: 988577970

View in Genome Browser
Species Human (GRCh38)
Location 5:32444722-32444744
Sequence CGGTCTGTTCTCCGCTGAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 58}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988577970_988577979 24 Left 988577970 5:32444722-32444744 CCTCCTCAGCGGAGAACAGACCG 0: 1
1: 0
2: 0
3: 3
4: 58
Right 988577979 5:32444769-32444791 CGCGCCTGTGCTCGGCATCCTGG 0: 1
1: 0
2: 0
3: 2
4: 111
988577970_988577978 16 Left 988577970 5:32444722-32444744 CCTCCTCAGCGGAGAACAGACCG 0: 1
1: 0
2: 0
3: 3
4: 58
Right 988577978 5:32444761-32444783 TGCGCAGGCGCGCCTGTGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 98
988577970_988577980 25 Left 988577970 5:32444722-32444744 CCTCCTCAGCGGAGAACAGACCG 0: 1
1: 0
2: 0
3: 3
4: 58
Right 988577980 5:32444770-32444792 GCGCCTGTGCTCGGCATCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 183
988577970_988577974 1 Left 988577970 5:32444722-32444744 CCTCCTCAGCGGAGAACAGACCG 0: 1
1: 0
2: 0
3: 3
4: 58
Right 988577974 5:32444746-32444768 CGCCTCCGACCGCACTGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988577970 Original CRISPR CGGTCTGTTCTCCGCTGAGG AGG (reversed) Exonic