ID: 988577972

View in Genome Browser
Species Human (GRCh38)
Location 5:32444742-32444764
Sequence CGCAGTGCGGTCGGAGGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988577972_988577980 5 Left 988577972 5:32444742-32444764 CCGCCGCCTCCGACCGCACTGCG 0: 1
1: 0
2: 0
3: 17
4: 232
Right 988577980 5:32444770-32444792 GCGCCTGTGCTCGGCATCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 183
988577972_988577978 -4 Left 988577972 5:32444742-32444764 CCGCCGCCTCCGACCGCACTGCG 0: 1
1: 0
2: 0
3: 17
4: 232
Right 988577978 5:32444761-32444783 TGCGCAGGCGCGCCTGTGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 98
988577972_988577979 4 Left 988577972 5:32444742-32444764 CCGCCGCCTCCGACCGCACTGCG 0: 1
1: 0
2: 0
3: 17
4: 232
Right 988577979 5:32444769-32444791 CGCGCCTGTGCTCGGCATCCTGG 0: 1
1: 0
2: 0
3: 2
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988577972 Original CRISPR CGCAGTGCGGTCGGAGGCGG CGG (reversed) Exonic